The History of Harmonic Convergence


The History of Harmonic Convergence leading up to the present EVENT we are living through. Now can you feel it?

Why Does the Galaxy Matter to Us on Earth?


“The galaxy and galactic things figure prominently in the Mayan Tzolkonics. The Milky Way galaxy is the context within which all Life and thus all DNA lives in it’s myriad forms but that’s just the beginning”

White 8 Galactic Mirror is Tyrosine and has a 5GForce of White 6 Wind or pulsing spiritual communication.

The Universal context within which all Life exists is immense and beyond our human imagination but I won’t let that stop me. Today we are on White 8 Galactic Mirror so it is now time to take a look at much of what is beyond human knowledge that is not shared by our larger culture. The Urantia Book is one such thing and I’ll do my best to nutshell this particular piece.

Part I is The Central and Superuniverses. Part II is The Local Universe. Part III is The History of Urantia (Earth). Part IV is The Life and Teachings of Jesus in detail.

Our Milky Way Galaxy is the central nucleus of our Superuniverse Orvonton. It’s the seventh superuniverse. Orvonton is south of the Milky Way Galaxy and Earth and it are in the southeast sector of Orvonton on the outside edge. We’re edgy, maybe even leading edge. Our local neighborhood universe on the southeast edge or Orvonton is Nebadon. The local system in Nebadon in which we reside is Satania, I suppose named for the once highly regarded and ever trusted angel of light, Satan. Please note that now he is regarded as the epitome of dark. Even in the Universe, people aren’t too big to fail.

That all changed and there are multiple stories of the Great War in Heaven in every culture. There is one in the Urantia Book and it’s pretty awful. I’m not going into that now. We’re sort of going through it ON EARTH right now and are at the tail end of what the benevolent ancestors watching over us are going to allow. Humanity is held like a babe in it’s mother’s arms. We are very guarded and cared for despite how other humans feel about each other. The Universe does not regard us lowly. We are held in high regard and our evolution means EVERYTHING to our watchers.

The Master Universe encompasses all of material creation. It includes the central universe of Havona (Heaven), the seven superuniverses and the four uninhabited outer space levels which revolve alternately clockwise and counterclockwise around Havona. In outer space millions of new galaxies are in the process of formation. The first outer space level is about 500,000 light years beyond the periphery of the Grand Universe.

That’s just a nutshell of the context of our galaxy. In the order of things, The Tzolkin, The Network Grid, galactic energy is about modeling integrity and harmonizing. White Mirror reflects Order and Endlessness which is why I brought the Urantia Book into the mix today. I’ve read the whole thing over a thirty year period and pick it up often and read it again.

If you’re interested in the details of the Lucifer rebellion it’s on pages 601-620. If you don’t have the book it’s also online. Lucifer and Satan are apostate princes and I do believe their mischief is at it’s end now, as of a couple days ago. It says they fought against the Dragon which is likely synonymous with the Red Dragon Tribe, The Dragon Family of China and The Draco E.T. who were just recently routed from the planet by the Pleiadians. The Tzolkin teaches all of that history and the DNA is all in there. Earth is a hodge-podge, a pluralistic fertile pool if you will and now we’re trying to harmonize all of it.

https://urantia.org

Our Superuniverse filled with myriad of inhabited worlds

Searching for A Universal New Year: The relevance of August 13th. By Rohaan Solare (my friend)


Presently there is no universal basis for what qualifies the start of a new year. Every culture has its own set of parameters for determining it. The Chinese celebrate theirs in either late January or early February according their lunar calendar. The ancient Egyptians linked the appearance of the star Sirius and the annual flooding of the Nile river to signal the start of their new year. (Lions Gate 8/8/20) The many cultures of India celebrate the new year on various dates during the month of April. Europe’s Nordic cultures keyed it to the Winter solstice. The Celtic, Samhain, now vulgarized as Halloween, is celebrated by present day neo pagans, Wiccans and Druids as the start of their new year.

The Maori of New Zealand looked for the appearance of the Pleiades in May to signal the start of the new year. The Hawaiians also pegged their new year to the appearance of the Pleiades, but their new year fell in October.

The Aztec-Mexicans celebrated the new year in early March several days before the spring equinox. Even the Maya celebrate 2 different new years dates. One equates to February 22 and some celebrate July 26th. (Dreamspell Version)

And then there is Gregorian January 1st to mark the start of the new year for Westerners. January 1st was arrived at as the start of the new year in order to honor Julius Ceasar’s exploit as the founder of the “rational calendar”.

Contrast that line of reasoning with the fact that the new year of non-western cultures is related to some seasonal and/or astronomical aspect. The foregoing is why I refer to the Gregorian calendar as an urban calendar, for it reflects the whims of the city lords more than anything else.

The most common denominator for the start of the new year in most other calendar systems is the start of the growing season or end of the harvest season. In some cases, either of the solstices or equinoxes are recognized as the start of the year. The start of the new year for cultures other than the Euro-western is related to the agricultural, seasonal, and astronomical particulars of each region.

A Bi-Universal New Year?: Solsticial New Year

Many pre-Christian cultures of Europe’s northern hemispheric latitudes recognized the winter solstice as the start of the new year as the Sun symbolically dies and is reborn on that day.

The start of the new year cycle can be viewed as universal for those in northern hemisphere when reckoned from the winter solstice, and as defined by the life cycle changes that accompanies the attendant atmospheric conditions (rain, dryness, snow, etc) as the sun ascends and descends. The same would apply to those of the southern hemisphere, except that their new year would start with what we in the north refer to as the summer or June solstice. I prefer to designate the solstices according to the month they take place within rather than say summer or winter, because the seasons are reversed depending on which hemisphere you happen to live in.

The process of cooling and warming is minimized in most parts of the tropical regions. The most defining aspect of seasonal variation in the tropics is dry and rainy seasons. Nonetheless it is the Sun’s to and fro movement, and its attendant affect on atmospheric conditions that drives precipitation patterns. Therefore we can associate the start of the new year with the solstice that marks the start of a rising Sun for each hemisphere, since it is the rising solstice Sun that initiates the life cycle for each hemisphere.

The solstices do indeed provide us with fixed starting points for each hemisphere’s respective new year as it relates to the life cycle, but might there be a truly universal new year that applies to the entire planet as a whole regardless of local particulars?

The Arguellen Universal Calendar Proposal

Jose Arguelles proposed the universal adoption of what he calls the 13 Moon Calendar. Thirteen “moons”, or months of 28 days, plus one day would give a clean, orderly and easy to use civil calendar. (13×28 = 364 +1 = 365) I won’t go into all the reasons on why a uniform calendar is far better than the Gregorian hodge-podge we have now. But if you think about it some of the reasons should become clear. He was not the first to propose a new and improved universal calendar.

His calendar proposal is based on the Mayan Tun Uc calendar which also measures 13 months of 28 days plus one day. Arguelles anchored the start of his 13 Moon calendar to July 26th. But why July 26th? What is so special about that date? The followingquote from his website gives us his rationale. 

“For many ancient peoples, including the Dogon and Egyptians of Africa and the Maya of Central America, the great star Sirius, the brightest star in the sky, was the galactic marker. The heliacal rising of Sirius – July 26 – commenced the Egyptian year”. ~ Jose Arguelles

The problem with his rational is that its mostly inaccurate. Sirius did loom large in Dogon and Egyptian cosmology, but I have yet to come across any information indicating that it had any sort of calendrical function among the Maya.

Additionally, the Dogon did not use the star Sirius as a calendrical marker. And the start of the Egyptian new year is July 19th not the 26th and the helical rise of Sirius is also around the same time–July 19-20.

Lastly, we did not understand the concept of a galaxy until the 1920’s when we discovered, thanks to telescopes, that we inhabit one of billions of galaxies. The Arguellen account does not give us any reason whatsoever to say that July 26th is the start of some universally valid new year, even though he insists it is.

There are two testable and key parts to his universal year cycle proposal. One is that it starts on July 26th and the other is that each of its 13 months are characterized by a set of qualities in the same way that each day of the Tzolkin’s 13 day tone cycle has it particular qualities.

In other words the 13 day tone cycle is a fractal of the 13 month year cycle, as proposed by Arguelles. The first month of the 13 month year cycle carries the same qualities as the first tone of the 13 day tone cycle and so on. But this article will focus solely on the question of universal new year and its probable start date, if one exists.

So what else can be said about July 26th?

The 365 day civil calendar of ancient Mesoamerica was known as the Haab among the Maya and as the Xiuhpohualli among the Aztecs. The ancient Mesoamericans did not anchor their civil calendar to any part of the year in the way the Gregorian calendar does by adding a leap day every 4 years. This means that the start of Mesoamerica’s civil calendar year drifted by one day every 4 years.

At the time of the Spanish invasion, the first day of Mayan Haab calendar, “0 Pop”, coincided with July 26th, and hence forth the Mayan Haab was fixed to July 26th for unclear reasons. Spanish imposition is most likely the reason for the Haab’s fixation to July 26th.

July 26th is also significant for one other reason, for it is the day that the Sun is at the zenith over two of Mesoamerica’s most important pyramid sites. Teotihuacan marked the solar zenith passage date for the Toltecs and Edzna marked the July 26th solar zenith passage for the Yucatec Maya.

But there is still nothing universal about a Spanish imposition, nor are solar zenith passage dates, for they will vary according to latitude within the tropics of Cancer and Capricorn.[fig. 1]

Finding the Center of Space and Time

The Tropic of Cancer is Arguelles N. Polar Zone in assessing the DNA in synchronicity with the earth, and The Tropic of Capricorn is the S. Polar Zone for the same reason. In between them is the Zone of Transformation. This is the alignment in EVERY CELL OF DNA ON THE PLANET and accounts for the double helix and radial polarity. -My comments, Lisa K. Townsend

August 13th is most famous for being the alternative start date for the beginning of the Maya Long Count Cycle. There is a 2 day discrepancy between when the Long Count may have actually started. The account with the most backing says its August 11th, 3114 BCE, and that date gives us the end date of December 21st, 2012. August 13th gives us the end date of December 23rd.

The Zapotec-Shearer-Arguellen Tzolkin may be able to shed some light on that subject, but that investigation will be for another time. And after this analysis I am inclined to think that August 13th may carry more weight than August 11th. The other principle reason that August 13th is well known among Maya scholars is due to the unique timing phenomena that occurs on August 13th, at the latitude of 14.8 north. I will have to forego the extremely fascinating history behind the discovery of August 13th at the latitude of 14.8 N for this article, but I will relate what is most salient to my purpose here.

The latitude of 14.8 north has the distinction of being the place where the sun’s two zenith passage dates combine to equate interval periods of 260 days and 105 days (105 + 260 = 365). Two hundred and sixty days is the number of days in the Tzolkin cycle calendar, or the most revered body of knowledge in all of ancient Mesoamerica.

Zenith passage dates can only occur between the tropics of Cancer and Capricorn.[fig.1] As the Earth tilts on its axis, we see the Sun rise and fall in the sky over the course of the year. The tropics, or the lines of latitude just mentioned, mark the Sun’s northernmost and southernmost points of inclination and declination. The tropic of Cancer is located 23.5 degrees north of the equator, and it marks the day the Sun is directly overhead on the June solstice. The tropic of Capricorn is located 23.5 degrees south of the equator, and it marks the day the Sun is directly overhead on the December solstice.

It has been suggested by many scholars that the 260 day Tzolkin and the 365 day civil calendar were developed at the ancient ceremonial site of Izapa. Izapa is one of two major ancient Mesoamerican ceremonial centers that are located at the latitude of 14.8. The other site is Copan which is found on the border between Honduras and Guatemala. [fig.2] Izapa is located near the Mexican-Guatemalan border.

John Major Jenkins and a few others believe that the Long Count Cycle was calibrated at Izapa, and they are probably right about that, but from my vantage point I believe that neither the Tzolkin cycle nor the 365 day calendar were discovered or formulated there.

I won’t get into my version now, but I will say that I believe that the Ancient Mesoamericans (AMA) sought out the place where the two primary measures of time, the Tzolkin and solar cycles met in perfect harmony.

Such a place would be nothing less than the place where the “Heart of Earth” meets the “Heart of Heaven” within their worldview. The Heart of Earth being the 365 pulses (beats) that we experience as a day-night cycle, and the Heart of Heaven being the 260 pulses of the Tzolkin cycle. In other words, the Tzolkin was regarded as the primary or cosmic timing standard. The implication is that the solar cycle is a local timing standard, particular only to our unique place in time and space, but nonetheless supremely relevant to why our solar system harbors life.

Orienteering 101

In order to show what is meant by the foregoing, let’s begin with the Sun at the December solstice. On the Sun’s northward journey it crosses the zenith over Izapa on April 30th.

The Sun continues climbing until it stops its northward journey on the June solstice, or the day the sun is directly over the tropic of Cancer, and once again begins its southward journey toward the winter solstice. On its southward journey it will again be directly over Izapa on August 13th for its second zenith passage.

Please note that our warming season from winter to summer solstice corresponds to when the earth’s northern hemisphere is tilted toward the sun and the opposite is true in the winter time.

April 30th to August 12th equals 105 days and from August 13th to April 29th there are 260 days. (260+105=365) The two solar zenith passages are separated by 105 days in the former interval, and by 260 days in the latter.

The interval from August 13th to April 29th places the December solstice smack dab in the middle at 130 days or one half of a Tzolkin Cycle.

Furthermore, there are 52 days from the summer solstice to August 12th, and we well know that the number 52 was highly revered by the AMA for its meaning within their understanding of time.

August 13th would be the equivalent of our January 1st and August 12 would be the same as December 31st.

But why August instead of April?

August 13th came to be known among the AMA as “the day the world was born” and “as the place where time began“. But why did they pick the August zenith passage date over the April zenith passage to anchor the “day the world was born”, and mark the start of the new year and the Long Count cycle?

The one thing that comes to mind is that they recognized the December solstice as the start of the solstice to solstice year cycle, and so that would make the August zenith passage the second or completing zenith passage date, hence completing the centering aspect of the Sun’s passage and the next passage date is a full 260 days away with the winter solstice perfectly balanced between the 2 zenith passage dates.

We must remember that one of the AMA’s most important cosmological quests was worldcentering, therefore they would value counting the year cycle from center point to center point, rather than from extreme point (summer solstice) to extreme point (winter solstice) so to speak. Following this line of reasoning, I looked to the night sky to see if it could shed some light on this subject.

I set my astronomy software to 3114 BCE to see if the night or day sky at the zenith time over Izapa might reveal something telling about why else the August 13th zenith date might have been favored over April 30th. I discovered that the Milky Way straddles the north-south meridian at midnight in such a way as to form a perfect cross just 20 degrees from the zenith. The four quarters of the world are made manifest by such an event, and the observer is at the very center of it all. On April 30, the Milky Way is not perpendicular to the zenith meridian until the dawn.

The actuality of the evening’s most revered object, the Milky Way, forming a cross with the north-south meridian at the zenith and at midnight, on the same day that the day-time’s most revered object, the Sun, is at the zenith only reinforces the idea of August 13th as the center of space and time in the most literal of terms.

There is one other consideration, and that is the agricultural season. The first corn crop is sown to coincide with the start of the rainy season around the end of April-start of May – the time of the first zenith passage. The first harvest happens right around the middle of August or near the second zenith passage. We know that harvest time is often a factor for pin pointing a year cycle start date among other cultures, but this aspect, unlike the first two, is not a universal condition, and we are looking for universal parameters.

August 13th: Ancient Mesoamerica’s Universal New Year

It seems that August 13th was regarded as the start of a universal new year among all major pyramid building cultures of Mesoamerica. It has been found that at least one major aspect of almost every major ceremonial center has an axis or focal point of some sort aligned with the sunset of August 13th. In other words it was widely acknowledged that Izapa was situated at the “Heart of Earth” and that the work done at Izapa was supremely important to the foundation of Mesoamerican cosmology.

In acknowledgement of Izapa and August 13t, other ceremonial centers oriented at least one major structure toward the sunset of August 13th. In other words Izapa represented nothing less than the place where the tangible fulcrum of earthly time, and the intangible fulcrum of cosmic time met in perfect harmony.

Three hundred and sixty-five days is the measure of earthly time and 260 days is the measure of cosmic time. Heart of Earth and Heart of Sky are two very important metaphors in Mesoamerican cosmology, for they too, like so many other cultures, recognized that everything emerges from some infinitesimal center place.

The perceptible Heart of Sky is the zenith, and also from Izapa they discovered the intangible, but supreme center of our local universe, or the heart of our Galaxy.

So it was that they developed the Long Count to calibrate when Father Sun would be reborn from the Cosmic Mother. (Jenkins Maya Cosmogenesis). By doing so they achieved the holy grail of Mesoamerica’s other great quest known as Worldrenewing.

For more on the concepts of Heart of Earth-Heart of Heaven and Cosmic and Earthly time, please see Cosmic Time Meets Earth Time: The Numbers of Supreme Wholeness & Reconciliation Revealed

Before concluding I want to go back to July 26th. As mentioned earlier the zenith of July 26th was marked by the ceremonial centers of Edzna in the Yucatec Maya lands, and at Teotihhuacan – land of the multi-culturally composed Toltecs.

Edzna was the first major ceremonial center of the Yucatec Maya and Teotihuacan was the major ceremonial center for the highland Toltecs. The pre-imminent Maya scholar Vincent Malmstrom thinks that the northern periphery of grand Mesoamerican culture, as marked by Edzna and Teotihuacan, switched the official start of the new year from August 13th to July 26th.

According to Malmstrom, a calendar reform of sorts took place in the year 48 CE, in which July 26th became the new “new year” start date for the Yucatec region and Teotihuacan, since both centers were built where the sun is at the zenith on July 26th.

We don’t know exactly what prompted this change, but Malmstrom thinks it had to do with having a “locally relevant new year”. It may have been a political tactic to establish Edzna as the new power center of an emerging civilization.

Even so they continued to acknowledge the universality of August 13th as they made sure that one axis of a major pyramid was oriented toward the setting sun of August 13th. August 13th became a foundational orientation to many if not all major ceremonial centers.

Earlier I mentioned that the Maya civil calendar, the Haab had been fixed to start on July 26th at the time of the Spanish invasion. Thus the prominence of July 26th in the historical record was doubly reinforced, since the roving start date of the civil calendar, and the July 26th solar-zenithal passage new year are two distinct ways of measuring the year cycle.

Recently I met a Maya man from Guatemala, and he did confirm that July 26th is still recognized as the first day of the new year, and this had nothing to do with the Arguellen proposition to create a new universal calendar with July 26th as its start date. Arguelles it seems borrowed the start date for his universal calendar proposal without giving full disclosure as to why he had chosen that date.

Conclusion

August 13th has a couple of strong reasons as to why it’s a prime candidate for a universally valid start of the year. July 26th is another serious choice because of its strong presence in the historical record. However, there are problems with the July 26th date because we have yet to discover any universally valid properties to that day.

Whatever the case, the month of August looms large in the historical record as it relates to the story of 2012 and Mesoamerican history. The following list of events only seems to affirm the significance of the time period called August:

  • Either August 11th or 13th is the start date of the Long Count Cycle.
  • Hernán Cortés began his march on the Aztec capital on August 16th, 1519.
  • The Aztec Empire fell on August 13th, 1921.
  • The atomic bombings of Hiroshima and Nagasaki happened on August 6th and 9th respectively.
  • Tony Shearer fulfilled the prophecy of the 13 Heavens and 9 Hells prophecy cycle by calculating its end date on August 16th-17th, 1987. The fact that Arguelles was able to successfully convoke a global gathering on those two dates (Harmonic Convergence) lends even more weight to mid-August as some sort of peak moment in the solar cycle.   Harmonic Convergence was a major event in the history of humankind, for it was the world’s first global ritual event and it took place before the internet was publicly available.

Those of you familiar with my article on Anticipating Personal and Collective Shifts in relation to MAC Time Science, should consider mid-August 13 as a cycle juncture window. A cycle juncture window is a period of time before and after a cycle ending zero date or August 12th in this case. Shift-type events are most likely to happen during a cycle juncture window; review the article in question for more details.

May you all have a joyful August 13th!

Continue reading “Searching for A Universal New Year: The relevance of August 13th. By Rohaan Solare (my friend)”

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that. I agree with social distancing but not the masks. Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

Organizing Your Mind; How?


I and millions of people meditate daily. I’m addicted to it. I’d put it right up there with great coffee or sex. It’s a tonic for the mind. Humans are different in the animal kingdom in that we have the ability to be self-reflective. I’m trusting my readers are able to ponder their feelings, actions, motives, and past experiences so they can learn who they really are. If you do start to ponder it’s easy for your mind to start to spin with ideas, memories, thoughts, feelings and intuitions.

In order to make some real progress with mental focus, it’s helpful to decide what you’re going to focus on mentally and put the others in a folder in the back of your mind. In order to do that, you must be clear on what you want to accomplish that day and what your time looks like. Make this decision before you meditate. That way, your spirit guides know what you need help with. You decide, they don’t! On other days, I’ll observe some odd inclination I’m having and figure out what I’m feeling to understand why I’m doing it.

The truth is, my life is extremely abundant and I’m grateful daily. I mostly did it myself but definitely had help. We all have help reaching our abundance goals whether they be psychological, money, or spiritual. You have to start by asking for help though which means getting past your ego.

Today is Blue 6 Night which hands us the energy to pulse musically with what makes us feel good, focused and abundant. Let’s keep the definition of abundant open to more than money. Enough money is definitely an important tool but it doesn’t bring health, mental stability or clarity about feelings. I think money is only 15% of abundance. Loving yourself and knowing how you feel is 75% of abundance. Liking your body set up is the other 10%. I guess I’m speaking for myself.

The analog and guide power are Yellow 6 Warrior and Blue 6 Night again. Saturn is the mediating planet. Therefore our minds are disciplined with help from Saturn to decide what we’re going to think about and not think about. There is no compulsion here. Just make a simple decision and do it. Sometimes it’s that easy.

The antipode is Red 6 Skywalker which compels us to movement and exploration in order to distract ourselves from getting our thoughts in order. I am Skywalker and I get bored so easily having to focus on one thing. It’s truly maddening to have to apply my antipode, this Blue Night theme to my mind. I compromise through my writing. Writing allows me to continue o explore the ether creatively while sitting still. I do manage to get things done but they’re not usually as perfect as I’d like them to be.

The Hidden Wisdom is White 8 Mirror, galactic reflection! That’s a good reason to sit still. The galaxy is unlimited and there is so much hidden from us by State and Church. They keep all the info. left on this planet for themselves. Order is one of the attributes of White Mirror though so we have double, maybe triple help getting something fruitful done. Have a great Thursday.

MOLECULAR LINE-UP

We see the Jupiter pentagon on the histidine molecule while the Moon is in Sagittarius. Jupiter rules Sag . And we see the Saturnian hexagon on the tyrosine molecule with the Saturn attributes or order, discrimination, ritualistic, discipliner, well coordinated and practical.

The Facts of Evolution Overstep Fate and Destiny


I’ve bothered to bring ancient wisdom and systems of organizing and seeding DNA on Earth down to the molecular level because of free will guiding evolution. The attribute of free will is manifested by the Yellow Human tribe. Up until now, evolution has either been esoteric and in the realm of New Age Religion or in the lab with the reductionist geneticists using Crispr to slice and dice our DNA.

All religions have been a step forward for humans except for the superstitious parts that require no critical thinking. Generally you have a prophet, a seer, a visionary and a teacher. The new age movement has plenty of those types and unfortunately there is usually some strong, intelligent woman behind the Kings throne to keep him socially cued in. I still see it everywhere in 2020 and she still has to be beautiful and hang on his arm. She is capable of being the leader, but even in the New Age religion, men are men. They are egos that need to try to get territory and dominate because generally speaking, they’re not as strong as women. We tend to dominate this planet, walk into a room even with our shirts on and the men’s mouths drop open. Women have tremendous power just by our physical presence. That’s not the effect men have on women but we are most definitely paying attention and appreciate beauty. Well, I am. I love the line on “Big Bang Theory” where Leslie Winkle says, “Come for the breasts, stay for the brains”. That’s gold. Most men don’t stay for female brains unless they have brains themselves but being men, they need to feel dominant so many times will pick a woman less intelligent than him. Smart women still end up alone much of the time no matter how they look.

On Earth, we still have a problem with the subconscious programming of gender roles seeded in us by our parents generation who went through tremendous trauma to survive the cabal and their nefarious lies and actions. It may take us a while to heal that. In that sense, the New Age religion has been no different.

However, now it’s time to seed a New Science that has at it’s foundation the intended oneness of Mind, Body, and Spirit. Our body IS our Mind and IS our spirit. There is no more degradation of the body, women, sex, and celibacy. We know synchronicity is real and that in the Matrix it’s not about coincidence, ever. Everything happens for a reason.

But today’s Theme, Red 13 Earth TRANSCENDS synchronicity which is an attribute of Tone 13. Cosmic kin transcend, have presence, and endure. We go past what is normally understood or seen and are therefore leaders for the people.

Cosmics have the patience of a great tree. We have enduring patience and perseverance.

Trees are archetypes for EVOLUTION. Red 13 Earth kin navigate the Matrix, transcending synchronicity in order to EVOLVE. The great lesson of this kin is that on Earth we have the power of birth, intelligence, freewill, and SEEDS. Yellow 1 Magnetic Seed in the Hidden Wisdom. All good things on earth come from seeds and we must respect and guard them well. Why? Because seeds are little DNA packets. They are time travelling pods and ensure the future of Earth and our progeny; animals and plants.

Given all of that, the edicts of control, fate, the gods, and destiny are cast out by Earth’s children. We create our own destiny. There is no fate or control of the gods as told to us in Greek myths and others. The Tzolkin doesn’t even control us; it just organizes the Matrix. Everyone’s intentions IN TIME have to coalesce in an orderly fashion or there would be more chaos than there already is.

The analog support is White 13 Wind. This is divine breath, God speaking through evolution. I’m down with that and I’m listening. The Guide Power is Red 13 Dragon, Rupert Sheldrake’s birth theme. He teaches morphic resonance. That melds perfectly with terrestrial evolution and divine inspiration.

Morphic resonance, Sheldrake says, is “the idea of mysterious telepathy-type interconnections between organisms and of collective memories within species” and accounts for phantom limbs, how dogs know when their owners are coming home, and how people know when someone is staring at them.

Sheldrake is inferring what Arguelles inferred all the time; DNA is Time.© There is Interconnection between a DNA organism and collective memories which are time, is the way I would say it. And it’s not mysterious. I have it figured out and I’m putting it in a database to be analyzed. There is rhyme and reason to it.

The antipode is Blue 13 Hand or ongoing healing. I swear I’ve been a healer in every lifetime from planet to planet. I could do it in my sleep. My hands are so attuned to the natural body I can’t fathom calling myself a healthcare worker and not touching the body. It’s so bizarre to me. The boundaries are in my mind. I wouldn’t dream of crossing pa physical boundary with a patient yet sometimes I feel they want me to given the tremendous dysfunction in our society with regard to the body.

No one touches anyone with kindness. When a bodyworker does touch them with kindness and excellent therapy, some are confused. It’s a travesty. The human body is OBJECTIFIED because of our psychotic sick care system and no one is educated about how their body actually works. The doctors aren’t even educated that well. If Church and State can keep you ignorant about the unlimited power of your body to heal, bring pleasure, and accomplish what you wish, they can control you. That has been the status quo and is even now with this planned virus event.

MOLECULAR LINE-UP

The bottom two, isoleucine (Blue Hand) and valine (Yellow Seed) are identical. The power of the Earth and it’s elements TO HEAL naturally is deeply seeded on Earth.

Set Your Intentions Daily or You’ll Be Programmed By Outside Forces and Media


From Abraham-Hicks. Notice these are all emotions that send you onto a certain path. They don’t have to control you.

I have to say, no matter what malarky is happening around me in human society I’m almost always at a 1 on the upward spiral. I don’t listen to or follow humans. Daily, I work with the universe and that’s how it’s always been for me. Maybe I’m a humanoid. I don’t know. We’re all just people evolving. The downward spiral is delusional lying to yourself. None of that is real. But I’ve learned people have reasons for sitting in shadow and I ABSOLUTELY accept it. Maybe it’s creative for them! There is no judgment and the universe watches over everyone.

The mental programming that’s going on right now is far more dangerous than CV2. I saw the most sinister, propaganda article by Google yesterday that stated that if everyone “cares” about one another by wearing a mask, CV2 will disappear. WOW! None of that is true and the experts will tell you that. Viruses never go away they just mutate!

The powers that be continue to play on natural human good intentions and good will to suck the life out of us for their nefarious purposes which would blow everyone’s mind if you knew the truth. Let’s just say we live in an inhabited universe and some humans have made alliances that are better for them than us.

Once a virus is born it never goes away. It just keeps mutating until it turns into DNA over a long period of time. By then it’s not very potent and doesn’t mutate on it’s own like the RNA retroviruses. And it’s ever so easy to get into a host since it’s microscopic. Nothing can stop it. They won’t tell you that. IF YOU BREATHE, and everyone has to breathe or you’d be dead, it’s already in you and just sitting there like every other virus on the planet eating the bacteria in your body that you no longer need. It’s no big deal as long as you’re chill and are happy.

That gets to the point of the today’s title. You’ve got to be inward and focus on controlling your own mind. We all came to this planet to check out the digs, to explore. Red 9 Skywalker is all about pulsing to explore and that is today’s theme.

The Skywalkers never give up and don’t lie. We have a code of ethics.
  1. The analog support is White 9 Worldbridger which realizes intention and pulses opportunity
  2. The Guide Power is Red 9 Moon which realizes purification and pulses flowing, universal water.
  3. The Antipode is Blue 9 Night which pulses dreams and intuition and realizes abundance
  4. The Hidden Wisdom is Yellow 5 Star which pulses beauty and art and realizes elegance.

With the New Moon in Cancer today and all of this new cosmic energy we can dream up a more beautiful, creative space for ourselves where we live. I was cleaning like crazy this morning and have new plans for my office to please my patients and myself. There is always room for improvement! The Moon is the mediating planet for the Guide Power, Red Moon.

MOLECULAR LINE-UP

Knowing and Admitting Your Feelings About a Situation is Really Important


Welcome to another day in the matrix where synchronicity with All That Is are the road signs, as long as we’re paying attention. This blog is an attempt to free your VISION so that you glide easily between inner vision of yourself and your body and the outside world, or what we perceive as the outside world. I believe it’s actually ALL ONE Big Mind in the illusory hologram that we perceive with our five senses.

For thirty years I’ve witnessed and been personally involved in amazing, unmistakable synchronicity that can be explained no other way. So have countless others. But there is still this outside screaming chorus of CONTROL from the spiritually ignorant, greedy, bitter victims and psychopaths that would have us believe THEY are in control of the Matrix. Yeah, no. But in this local universe they are free to try up to a point. I can tell you that the E.T.’s helping us have time and again shut down our nukes and that will continue. They are not allowed to destroy the human race or the Earth. It’s in the contract.

The Matrix command and control is Galactic Center. We live in a Grand Universe that is organized according to Love and Light but because of free will, dissent, evil, violence, resistance and mischief are allowed to exist. There are 300 species of E.T. alone on THIS planet, underground, among us as humanoids, and in our local solar system. They are NOT a threat to us but we are EVER SO MUCH to them because of our unwillingness to control our drama and bodies. Humans need to get with the program and become CO-CREATORS instead of reacting like little children all the time. E.T.’s are just people. Hopefully soon all will be disclosed and the intelligence they’ve left us will come to the surface.

Knowing our Feelings is EMPOWERING!

Today is Red 5 Moon or Radiant Methionine which is the START CODON for the tRNA in all RNA sequences. It’s attributes are; purification, flow, and universal water. I talked extensively about water, hydrogen, and the tetrahedron yesterday without realizing that TODAY was the Water archetype. It’s analog is White 5 Dog which is Radiant Love. Red 5 Earth is the Guide Power, Blue 5 Storm is the Antipode and Yellow 9 Human is the Hidden Wisdom. The nutshell of that is, our bodies and feelings are bonded to Love and Loyalty. That truth is our accurate NAVIGATION in the matrix. Notice I didn’t say we ARE our feelings or that we should SIT IN our feelings. They are just road signs and then should be released. But don’t ignore the road signs in the Matrix or you’ll go off your rails. Our challenge and gift is to use that to catalyze SELF-GENERATION and INTERNAL ENERGY or QI. As Solar children, children of the Sun and the earth, our wisdom is to accept who we are in this incarnation. Follow the Sun cycles and the Earth cycles, not humans and their institutions. We have free will and real influence with other species. We are creators and holders of the chalice, the Holy Grail. We are vessels of a higher power and some would like to steal that from us. Hold your boundaries with the FOCUS of your mind. Navigate your body and mind. The Universe has your back. It’s not useful to offload your story or drama onto other people right now. Just align your daily behavior with your internal power. People can feel it. Act more, talk less.

MOLECULAR LINE-UP

  • Red 5 Moon is the theme; Methionine, the start codon
  • White 5 Dog is the analog; Aspartic Acid
  • Red 5 Earth is the Guide Power; Phenylalanine
  • Blue 5 Storm is the Antipode; Tryptophan and a type of Stop Codon
  • Yellow 9 Human is the Hidden Wisdom; Glutamic Acid

Just for fun, look at how similar the scientists depiction of a tRNA molecule looks to the Tzolkin Themeplex. Again, synchronicity. Just flip it to the right. The antipode/anti-codon is on the left.

Contains attachment site at the 3’ end for an amino acid. Contains a loop with the ___________. Fig ’ 5’ The anticodon base-pairs with a complementary codon on mRNA. If the codon on mRNA is UUU, a tRNA with a. ______ anticodon and a tRNA carrying phenylalanine will bind to it. The anticodons of some tRNAs recognize more than one________. Why? Because the rules for base pairing between the third base of the codon and anticodon are ________ (called______________).

Bring Light Into the Body to Survive the Mental Darkness of People Obeying Indolence


DRINK LOTS OF WATER-GOOD WATER!

The tetrahedron is the 4 sided geometrical shape we know as a pyramid. It has one unified point in the center and 5 vertices. Very synchronistically, a WATER molecule is a Tetrahedron. When you drink water you’re drinking microscopic pyramids. Every one of our amino acid proteins that make up every single cell of DNA in our bodies has hydrogen and the Tzolkin Harmonic regulates their movement as time which is DNA. It’s one of the main 5 molecules that compose all life. Hydrogen is the main ingredient in water. Hydrogen is literally called the WATER GENE. It’s the main gene that makes up our genes!

The Pyramid is a tetrahedron with 4 sides and 5 vertices

We know the origin of oxygen on the planet was the first algae that grew here but what is the origin of water? It is our ancient ancestors, the Life Carriers. They have the hydrogen gene and if the atmosphere is ready to grow hydrogen they bring it to the planet. Like most of our amino acids, they found hydrogen IN THE STARS. Stars are made of very hot gas. This gas is mostly hydrogen and helium, which are the two lightest elements. Stars shine by burning hydrogen into helium in their cores, and later in their lives create heavier elements.

TODAY IS Yellow 4 Star so it’s very synchronistic that I found this. From planet to planet, pyramids can be found in our local system. They seem to be structures that are a type of LAB to ground life force on a planet; life we all share. Maybe they are water labs. I haven’t read up on the pyramids yet but the Egyptians were partial to pyramids as well as the Maya and they were from our beloved Pleiadean star system which is closely aligned with VENUS, our mediating planet today.

The 5GForce is Yellow 10 Human which lends credence to the idea that bringing water to a planet from the hydrogen made from stars helps humans evolve.

“I perfect in order to influence. Producing wisdom I seal the process of free will with the planetary tone of manifestation. I am guided by the power of universal fire. I am a galactic activation portal. Enter me.“-The Dreamspell

The Planet Venus mediates Yellow Star and Blue Monkey; leucine and  asparagine.

https://www.resonancescience.org/blog/Tetrahedral-geometry-of-water-found-to-account-for-its-remarkable-properties?fbclid=IwAR2IMPinYan1YOFpFvzWtS72fnu7Y2HgvfvoWOjTN1so8EbU7ewMJF-FzJ0

MOLECULAR LINEUP

  • Theme is Yellow Star-Leucine
  • Analog is Blue Monkey-Asparagine
  • Guide Power is Yellow Seed-Valine
  • Antipode is White Mirror-Tyrosine
  • Hidden Wisdom is Red Skywalker-Glutamine

Blue 3 Hand Healing Energy with Mars conjunct Chiron We can Accomplish Some Cleansing


It is a time of RELEASE from repressed energies. Our mission is to heal OURSELVES. Sure, we can help others somewhat but in the end, each individual has to finish it off alone. Only you know how you really feel. But we are ready to address problem areas.

The Moon is in steady Taurus so there is an earthy, grounded feel to these movements. We like things that are familiar and reliable. The Moon also has an alignment to Uranus though which is in the Themeplex as the antipode, so while Uranus has some novel ideas or approach it could be challenging as well as a gift for those that are used to habits. Uranus shakes things up! (Aquarius).

(Note: Donald J. Trump is also Blue 3 Hand. While it is true that he is likely the most hated, maligned, mistrusted person on the planet right now he is also in charge of DISCLOSURE at the highest political levels on our planet of Luciferian pedophila, incest, child molestation, addiction to blood sacrifice on the part of the ELITE and a certain evil that has permeated our planet for maybe 1000 years in every country. His mission is not to be a good President, which in my opinion, he is not. He has a thick enough skin to withstand rooting out the most pernicious evil, the most entrenched evil via the Illuminati institutions of religion and state the world has ever seen. I’m not sure he can accomplish it. Everyone wants him destroyed. He is pulling up to the surface, the collective SUBCONSCIOUS MIND of family abuse of children that everyone is in denial about and no one wants to deal with. )

This is a good time to mention that your birth themeplex DOMINATES your day, every day despite the spiraling of the Tzolkin. Think of your birth themeplex as the sun and the Tzolkin daily themeplex as a planet in orbit around you.

The 5GForce today is Red 11 Skywalker; I dissolve in order to explore. Releasing wakefulness I seal the output of space with the spectral tone of liberation. I am guided by my own power doubled.

MOLECULAR LINEUP