Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.
For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.
Here are the sequences of Covid19
As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.
I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that. I agree with social distancing but not the masks. Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!
The main analyzed regions
Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.
See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220
See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:
The planet on the right is Jupiter. Meditation is channeling and focus is targeting. Those are Yellow 7 Seed Attributes. We meditate within our bodies and then our body/mind interacts with MIND all around us. We can choose what we let in and what we don’t. Activating the power of our minds is frankly the only way we’re going to get out of this mess of others controlling the human race. We’ve let this happen by default.
Yellow 7 Seed resonates AWARENESS of the context within which we live and have our BEing. A physical seed is a DNA seed packet that drops to the earth and sprouts. A woman’s egg is a DNA packet that drops in the uterus, is fertilized and creates a human. That is an exact analogy to our MIND seed packets that we drop in the ether and they literally sprout. I’m asking you to meditate on the LITERAL nature of THE MIND and TIME as DNA and the power of Life Force that it has.
Look at the phenomenal plant life on earth that came from a tiny physical seed! Now imagine that 100 times or more with the power of human intention backed up by the timeless universe with regard to our thoughts and feelings. You may assert your positive gratitude and happiness path a bit harder instead of indulging in anger and pettiness on social media next time. The whole planet needs to PIVOT on that. I deactivated my Twitter account. That thing is TOTALLY negative. So is T.V. Negative mindset is the most destructive thing on the planet and we should not be part of it. In essence, we’re destroying ourselves if we do but maybe that’s what some people want because they literally don’t believe that Love and Goodness exist in the Universe. They don’t believe there is a God. Ok, then!
This process is called ATTUNEMENT and is also an attribute of RESONANT TONE 7. I am a Reiki Master and teach Reiki classes and do attunements for my students. Their mind and body has become aware of their Qi or Ki and now they have learned how to FOCUS their QI to heal themselves and others. It’s not much different than tuning up a musical instrument or the singing voice. I am also a degreed musician. The musician and actually all artists are athletes in that our creative expression comes through our body. You have to be in shape and in tune with your biorhythm to do well in your craft. That’s also the case with bodyworkers.
Being a Reiki Practitioner is like being a gardener organizing and tending to their garden. Each client is a Seed that wants to get comfy in the soil of their body and SPROUT! ReiKI is like the SUN.
The 5GForce today is Yellow 7 Warrior, the GUIDE POWER. That’s odd. The Moon was in Sag and is now in Capricorn so there is some affinity today between Jupiter and Saturn on every level.
The Theme in the middle is Yellow 7 Seed, Valine
Analog is Blue 7 Eagle, Arginine
Guide Power is Yellow 7 Warrior, Histidine
Antipode of White 7 Wizard, Lysine
Hidden Wisdom is Red 7 Earth, Phenylalanine.
The pentagon in histidine is tetrahedral which is the Hydrogen molecule. It appears to me that Jupiter has had a major role in making sure hydrogen is distributed to planets that are going to evolve life. Saturn has the hexagon which is in Phenylalanine. JUPITER is the mediating planet today.
Share this: Intuition UP! Lisa K. Townsend, Author
Whatever They Make and Market is Either Culling or a Placebo. It’s Not Medicine.
Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.
As you skim, please be sure to read the highlighted areas.-Lisa T.
My posting of today at the Research Gate: “By Sørensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical etiology of the SARS-CoV-2 Spike
This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.
“The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte“
“SARS-CoV-2 is possessed of dual action capability“
“Simultaneously it is capable of binding to ACE2 receptors“
“The likelihood of this being the result of natural processes is very small.”
“The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”
“A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”
“Why does this matter?”
“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”
“the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved“
“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”
“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”
“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”
“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”
“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”
“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”
“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”
“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”
“a designed mutated strain (initially) lacking the furin cleavage site residues was used”
“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”
“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:
1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!
“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”
“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”
“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”
“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!
“typically the objective of gain of function experiments… a strong indicator of manipulation”
“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”
“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!
Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”
“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”
“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.
“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…
“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!
“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!
“we now add here a forensic analysis”!!!!
Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:
“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”
“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”
“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”
Note:
So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!
But the fight continues as follows:
“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”
And the next one is a “classic” of infamy:
“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”
“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.
“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”
“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”
“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”
“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.
“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”
“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.
So, “the reconstructed historical etiology of the Spike (is) as follows:”
“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”
Conclusion “We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”
We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”
Share this: Intuition UP! Lisa K. Townsend, Author
The well-known Norwegian virologist Birger Sørensen and his colleagues have examined the corona virus. They believe it has certain properties which would NOT evolve naturally. These conclusions are politically controversial, but in this interview he shares the findings behind the headlines.
Dr. Chavez is currently working with the 2008 Nobel Laureate Luc Montagnier, the founder of the HIV retrovirus, on fleshing out the true nature of the Covid19 signature and he’s my friend. In between his important work I’ll get his attention, which I already have somewhat since he is familiar with the Mayan system as well and we are on the same page as we talk. Much of his work has fueled my project and I’m very grateful. -Lisa T.
“To the current director of the NIH:
As a Postdoctoral student of Molecular Biology, my focus has been on analyzing the sequence of the current COVID-19. It is so alarming to find the artificiality within it, that I have written to NIH director Frances S. Collins, entitled “A Vital Letter On The Preservation Of Humanity As We Know It”:
Dr. Collins,
As I have had the blessed confidence to write to a brother in Christ since day one, I am sending you this important message. With my best regards, Fernando Castro-Chavez, PhD.
P.S: I could not fit this vital link into the letter that independently exposes the hoax imposed on humanity 19 years ago. Let us do all we can to prevent this from happening again but on a wider scale.
AT LEAST SIX RESEARCH GROUPS HAVE FOUND HIV INSERTS IN SARS-CoV-2
Then, we saw you in person and introduced ourselves. You went to the BMC to give a speech about The Human Genome Project, I remember that you said something like: “Mendel is also there, in this slide, right there at the corner…”; then I wrote about our dreams to pursue, not only this Postdoctoral couple of jobs in Medicine but also an MD Career. We two are starting again from scratch. Dreaming to be truthful and to really help humanity… However, now, I dedicate myself to you my current findings, humble, but nonetheless, they are still findings:
1) “COVID-19: AATGGTACTAAGAGG (NGTKR) = HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene (GU455503)”. Finding also done by:
2) Shi Zheng-Li, from the WIV at Wuhan and co-author of Ralph Baric. She distinctively calls it an “INSERTION” (she puts it as GTNGTKR, GGGACCAATGGTACTAAGAGG, adding other two more, but skipping the key one: The Furin Site!), whose putative function is immunosuppressant, as she says that those INSERTIONS have: “sialic-acid-binding activity”, at Zhou, P., plus 27 et al & Zheng-Li Shi.A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020:579:270-73, & 16pp: https://www.nature.com/articles/s41586-020-2012-7.pdf; a third group that found these unique INSERTS is that of:
3) Sørensen (identical to the previous one: GTNGTKR, but also studying, to leave no doubts, its functional span by performing 6 by 6 NT iterations containing our sequence of interest (and of many others), such as VSGTNG, SGTNGT, TNGTKR, NGTKRF, etc.), who says in an interview, as he found many more INSERTS (saved at https://archive.vn/7TPTc): “The INSERTED sequences have a functionality that we describe.
We explain why they are essential: …accumulated charge from inserts and salt bridges are in surface positions capable of binding with cell membrane components other than the ACE2 receptor.” This statement is very important and indicates that if we realize that this virus is NOT natural we could be and could have been better prepared since the start to fight against it in a more logical, rational, and prepared way, which did not happen. The artificiality of the virus also makes it unsuitable for vaccination, instead of the opposite, because that is the way the human tampering of nature works. The attempted purpose of its design is to do one thing, and it happens to result in just the opposite thing than what was wanted: “…the naked coronavirus spike protein as a concept for the basis of a vaccine, which we have rejected because of a high risk of contamination with human-like epitopes.
Analysis of the Spike protein of SARS-CoV-2 shows 78.4% similarity with human-like (HL) epitopes…” and “… A search so tailored to match against all human known proteins will give a 78.4% human similarity to the SARS-CoV-2 Spike protein, i.e. if all epitopes on the 1255 amino acid long SARS-CoV-2 Spike protein can be used by antibodies then there will be 983 antibody binding sites which also could bind to epitopes on human proteins…”The original article delving into all of those technicians is: Sørensen, B., Susrud, A. and Dalgleish, A.G. Biovacc-19: A Candidate Vaccine for Covid-19 (SARS-CoV-2) Developed from Analysis of its General Method of Action for Infectivity. QRB Discovery (by Cambridge University Press) 2020:17 pp [Accepted Manuscript]: https://doi.org/10.1017/qrd.2020.8.
This important article clearly indicates that if we do NOT realize the real origin and the real nature of this virus, we will continue to be deceived as per its treatment and its strategies of attack, and will be responsible for having on purpose dimmed the light of its artificial origin. Especially when we all are aware that the authors of “The Proximal…”, Andersen et al. Nat. Med. 2020 article have been written by reefers that have ever been used for political purposes rather than scientific ones.
So, apart from as these three independent findings of that and many more related HIV sequences, we have another two sets of witnesses, totaling FIVE independent groups finding this: Mine, Zheng-Li’s, and Sørensen’s, but also:
4) Pradhan, from the Indian group that was forced to withdraw its article, who calls the contained sequence under consideration as the previous ones: “INSERT 1″: TNGTKR, elongating the set of meaningful nucleotides as TCTGGGACCAATGGTACTAAGAGG (SGTNGTKR): Pradhan, P. et al. Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag. Biorxiv 2020: 14 pp. (Withdrawn, 128 comments): https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1, they start describing their findings as follows:”We found four new insertions in the protein of 2019-nCoV- “GTNGTKR” (IS1)…”, but this is not all, but also a fifth group, being this the one integrated by:5) Perez and Montagnier (2008 Nobel Prize in Medicine, precisely for his discovery of the HIV virus), and they describe our found sequence within, together with a couple of tens more: TCT GGG ACC AAT GGT ACT AAG AGG TTT GAT AAC CCT G (SGTNGTKRFDNP…, finding them in here, fragments of SIV joined to the HIV-1A that I found, and sown in point “1”), from these sequences found by them, they start and end their meaningful conclusions, coming from the wisest of men, as follows:1) 18 RNA fragments of homology equal or more than 80% with human or simian retroviruses have been found in the COVID_19 genome;
2) These fragments are 18 to 30 nucleotides long and therefore have the potential to modify the gene expression of Covid19. We have named them external Informative Elements or EIE;
3) These EIE are not dispersed randomly, but are concentrated in a small part of the COVID_19 genome… …everything converges towards possible laboratory manipulations which contributed to modifications of the genome of COVID_19, but also, very probably much older SARS, with perhaps this double objective of vaccine design and of “gain of function” in terms of penetration of this virus into the cell. This analysis, made in silico, is dedicated to the real authors of Coronavirus COVID_19. It belongs only to them to describe their own experiments and why it turned into a world disaster: 400 000 lives, more than those taken by the two atomic bombs of Hiroshima and Nagasaki.
We, the survivors, should take lessons from this serious alert for the future of humanity. We urge our colleagues’ scientists and medical doctors to respect ethical rules as expressed by Hippocrates oath: do no harm, never and never!”; an earlier manuscript of them can be found at Perez, J.-C., and Montagnier, L. COVID-19, SARS and Bats Coronaviruses Genomes Unexpected Exogenous RNA Sequences. ResearchGate & OSF 2020:43 pp. [Older Manuscript]: https://osf.io/d9e5g/download/?format=pdf.
I started my letter saying that I used to have respect for you. However, the standing taken as to ignore the real origins documented by these five research groups and by countless others, of the whole pre-planning of the current Pandemic by COVID-19, has made me change my current opinion about you.
6)Arumugham also discusses such “Artificial selection at work… via recombination with HIV-1 derived inserts and selecting the viruses for efficient human kidney cell infection”, and my comment is again that to notice this artificial origin of COVID-19 is very important to do the proper treatment to patients, and to prevent another thing like this from emerging out of a Gain of Function “research”: Arumugham, V. Root cause of COVID-19? Biotechnology’s dirty secret: Contamination.Bioinformatics evidence demonstrates that SARS-CoV-2 was created in a laboratory, unlikely to be a bioweapon but most likely a result of sloppy experiments. Zenodo 2020:9 pp. (Manuscript saved at: https://archive.vn/N79Ci): https://zenodo.org/record/3766463#.Xuu9RTpKjIW
My experience on finding human artifacts on genomes dates back to the EcoRI palindromic linker that is contaminating thousands of sequences in the Genbank: Castro-Chavez, F. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes. DNA Cell Biol. 2012, 31(2):151-63: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3272245/
The freedoms of the whole humanity are at stake and the good God The Creator that you deeply respect, has put you in a key position as to be able to revert as soon as possible the current decline of the human values, and of the human nature in general, and this all because of a deliberate release of the current Sars-CoV-2. 9/11. It was the first False Flag Operation aimed at stealing as many freedoms as possible from the human race, and the Fake Anthrax Attack of 2001 had the same purpose, releasing a pre-planned and the very anti-patriotic document called the “Patriot” Act, which also included an immunity clause preventing the Pharmaceutical Industry of even more liabilities, but it was contested by the population, and it was removed. So, I wish to stop the GoF initiatives.
Here we are today, contesting the “official” narrative of the current Plandemic as we did in the past with the “official” narratives of 9/11 when we discovered nano-bombs and fake planes injected into the TV screens. I expect to publish this letter out in the open after you have read it. Only history will tell if TRUTH was able to win on this time over darkness, or if the criminals will get away once more… With my same thinking as at the beginning of the current letter (but praying that this could very soon change),
Fernando Castro-Chavez, PhD.
P. S.
My ongoing work can be found at the ResearchGate. While many pieces of it have been removed from Facebook and from the YouTube by some heartless and brainless censors appointed by the WHO and by their owner, Bill Gates, apparently the mastermind, chosen by the globalists to pull this event of an artificially manufactured viral harm for the whole of humanity, it is there. But as Mordechai told to Esther: “If you do nothing about it, God will raise somebody else to redeem us of this plague, because our clamors for freedom and for justice have already reached the Heavens”. Jesus said that it will not be so easy for the believers to overcome evil in the current times, but that it could be possible. As Christian believers, we believe that as long as we continue over the earth, the total fruition of the plans of darkness can NOT prosper, and you may be a key member of the Body of Christ in order to fulfill such restraining against the forces of evil of this world. Thus far, the next are some of the sequences that seem to be inserted (some of them seem to have been started to be tampered with since the RaTG13 “experiment” of Shi Zheng-Li, a genome she had since 2013 but that she did not publish until 2020 after the first Sars-CoV-2 had been published in China, a genome that of the RaTG13 (previously published in part twice with different names that included the number 4991.
That is dishonesty in science to change the names of the sequences, and that is what Shi just did!). It has been used, ironically, even with all its methodological anomalies, to precisely attempt to undermine the artificiality of the inserts. Even two sequences published earlier by the Chinese Military seem to have been already tampered with to make them more infectious. This is what happens when you only have the sequences provided by them with nobody else corroborating their authenticity), so, I may use the “probable” inserts clause, mostly from HIV-1, some few from HIV-2 and one from SIV (as explained by Perez & Montagnier, 2020).
So, the number of artificial sequences is growing as research progresses, that is why, when people try to discredit some of these from being artificially made, the burden is over them to explain how all of them got INSERTED into one same viral genome, which may have required the same animal cell with multiple different viruses and even bacteria exchanging only the specific required portions and no more, which is something naturally implausible but completely possible within a lab setting. (then I add here the list from my previous posting in response to Jennifer Clarkson, adding that there, (most of those sequences are concatenated sequences).”I have also added here my last comparison of the sequences found in Nsp3 by A. V., highly specific both to COVID-19 and to HIV-1.
The reason there are limitations is because of TIME regulating movement. Time is just the movement of our planet/planets around our star, The Sun. Time is not REAL in the literal sense but it is real in our 3D, 5 senses perceptual sense. Our minds are hypnotized with the reality of Time just like the mask wearers are hypnotized by the specter of certain death whether it be from CV2, a hospital respirator, a botched hospital procedure that they submit to or their violent mate. None of that is real in that it doesn’t exist unless the mind of the person CREATES it by obsessively focusing on it all the time as well as the T.V. PROGRAMMING of their minds that they can’t turn off because they’re afraid they’ll miss something, like a message from ON HIGH since whatever is said on TV is altruistic, all-loving God looking out for them. They have to believe that because they are bereft and empty without it. So, I give up helping.
We are on Tone 11 White 11 Wind today and a majority of Americans are still spectrally, chaotically, dissolving themselves in fear, in a puddle, anywhere they find themselves. They are doing it to themselves in their limitation, in their fear, in their unwillingness to think rationally or spiritually. Some however, are waking up. That said, the authorities are tying the hands of business and sending out checks so there is something MUCH bigger going on.
I have a new theory about the people freaking out over a virus and believing they have NO IMMUNE SYSTEM WHATSOEVER to kill a virus even though the facts of the last ONE MILLION years of human existence prove otherwise. They can’t listen. Why not?
I dissolve in order to communicate. Releasing breath I seal the input of spirit with the spectral tone of liberation. I am guided by my own power doubled
The Dreamspell by Jose A.
Because they don’t really believe GOD or SOURCE is IN them. They think it’s a load of B.S. They are cynical 3D materialists who only feel what they can see, touch, hear, feel, and smell. That’s all that’s real to them and they don’t mind a mountain of evidence proving them 100% wrong because they don’t want to do the work to LISTEN and hook up to Spiritual presence in them through mediation and movement. They are scared of that too because they feel guilty for being weak and selfish.
My ex used to always say, “If you make a mistake you are forgiven.” That is true. But if you don’t learn to work at helping yourself you’re doomed. People who care, helper people and light workers are not supposed to help people who won’t help themselves. It’s very dysfunctional and we’re done with dysfunctional. That is chaos and usage. Karma is coming your way and karma is coming people’s way who continue to sit in fear and are so willing to let our entire society shut down just because they’re scared and can’t think straight.
There is a reason this is happening. You either adapt to the new environment and energies or go. I didn’t make this plan. I’m just relaying it on a White Wind gateway because the human species has life to live and we’ve been given a lot of information that is about to come to the forefront so we can really change this planet. Let’s get cracking!
MOLECULAR LINE-UP
The middle one in the pink boxes is phenylalanine and tryptophan on the other side. They are almost the same, as usual; a synchronicity and no doubt key to protein folding.
Glycine is White Wind, Phenylalanine is Red Earth, Glutamic Acid s Yellow Human, and Blue Storm is Tryptophan.
Share this: Intuition UP! Lisa K. Townsend, Author
RE-acting is mimicry. Monkeys and parrots mimic. Humans also mimic unless they are mentally mature. Babies learn by mimicking but adults learn by creating. Humans are addicted to mimicry because of a lazy streak usually due to unresolved childhood issues. They’re still grieving parenting they didn’t get. That ship has sailed. You can parent yourself with the help of the universe and rival your parents. Don’t you want to win? I want my son to win over any mistakes his father and I made. Self-Creating, self-generating (Blue Storm tribe), Acting is all ART and comes from your Magic Nation or imagination.
Think of these two as a teeter tooter where you are deciding whether to go one route or another. In this case, are you going to DIY and send up a plan in your mind or are you going to continue your normal REACTIVE route where first you have to pull in something from outside of you such as another’s idea, T.V. , Twitter or Instagram and react to it, or are you going to sit quiet or workout, meditate, listen to your body and intuition and create your own plan from within yourself?
We are each at the precipice right now. Tone 2 is stabilizing by polarizing. It’s a simple choice; Self create, or React? Self create or React? The first one is INtegrity the second one is wash, rinse, repeat for your entire life and wastes everyone’s time and resources and nothing original is added to the planet.
Self-creating and acting involves:
Body care-organizing fresh food
Physical Activity
T.V. OFF
Water intake
Hand held device-limited
Organizing your money and bills
Meditation up to an hour a day
Boundaries with people who vampire your energy
No large group activities right now. Stay away
All of that is stabilizing. Stabilize yourself and don’t look outside of yourself to get someone or something to do it for you. Your MIND, your BRAIN is a magnet that turns your body into a magnet. It’s literal. The media is trying to program your mind to give your authority and magnetism over to them. Don’t let them in. Our immune systems, bodies, and minds are the province of US and the Universe has our backs. Freedom and balance are universal law. We are supposed to be evolving in freedom and balance otherwise we’ll be programmed to go over the cliff. That gets rid of the weak-minded ones. They obey.
5GForce: Yellow 12 Sun; I dedicate in order to enlighten. Universalizing Life, I seal the matrix of universal fire with the crystal tone of cooperation. I am guided by the power of free will.
SCIENCE STUFF
Yellow 2 Sun Themeplex
THEME; Yellow 2 Sun is the Stop Codon
ANALOG: Blue 2 Storm or Tryptophan
GUIDE POWER; Yellow 2 Human or Glutamic Acid has the extra carbon-hydrogen molecule which humans needed to evolve once we were on the planet
HIDDEN WISDOM: Red 12 Cysteine or Red Dragon. Notice the Sulfur molecule in Red Dragon. The Earth began in sulfur and Red Dragon is the first tribe.
Share this: Intuition UP! Lisa K. Townsend, Author
Our mediating planet is Neptune. It’s dreamy and visionary. We’re combining that with the Moon in Aries and a creative aspect between Saturn and the Sun. This is serious energy to get some creative work accomplished…finally. However, the Moon squares Jupiter later so we may not have made a concrete decision yet about what direction we’re headed.
The 5GForce is White 1 Wind in synchronicity with our Guide Power and it adds up to 14 which is Occult so there is more being revealed that was hidden today. Be sure to be tuned in, daydream, journal, meditate, create. There is big information afoot to be gleaned.
White Mirror attributes are; Reflection, Order, and Endlessness (Neptune and Saturn!). Mirror is pure, faces the shadow, is self-sacrificing a discriminator, ritualistic, disciplined, has the sword of wisdom, is well coordinated, has clarity, timelessness, and is practical and meditative.
We are looking at 13 Tyrosine in the DNA nucleus of the molecule with 13 Cysteine as it’s analog. As tRNA we see 13 Glycine, as antipode 13 Leucine and as Hidden Wisdom 1 Alanine. It spins to the left in our cells.
SCIENCE CORNER
The hexagon of Saturn is seen there in the Tyrosine molecule so Neptune and Saturn have something symbiotic. Notice the loaded carbon in Leucine which was an essential A.A. in our evolution for the formation of our muscles. And what is the meaning of Alanine and Glycine almost being identical? They are the guide power and Hidden Wisdom today. With the extra Carbon and Hydrogen atom in Alanine, it is indeed magnetizing or grounding our VISIONS from galactic center.
Share this: Intuition UP! Lisa K. Townsend, Author
Histidine is an amino acid that is responsible for tremendous bursts of energy from every cell in our bodies. With it’s analog Alanine, it affects the function of our muslces. It’s a survival, thriver amino acid that has allowed the human race to accomplish amazing feats and is tied to our cortisol levels which affects energy level.
SCIENCE CORNER
Effects of Histidine and β-Alanine Supplementation on Human Muscle Carnosine Storage
Carnosine is a di-peptide molecule, made up of the amino acids beta-alanine and histidine. It is highly concentrated in muscle and brain tissues. Carnosine and carnitine were discovered by Russian chemist Vladimir Gulevich.
Also in this themeplex we have White Worldbridger or Threonine as the antipode and Red Serpent or Serine as the Hidden Wisdom. There is an amazing amount of carbon in all of these molecules which helped humans evolve flesh onto our bones.
These molecules have very strong synchronicity with each other which is another sign that their line-up in the Tzolkin Harmonic Code is connected to our lives on earth. Through a binary triplet configuration and the 13 Tones of Creation, these 3D proteins fold into everything in our world. Once the scientists accept that what is esoteric underpins the nature of things, this information will be tested and processed to create a real healthcare system with a philosophy of Whole systems.
Share this: Intuition UP! Lisa K. Townsend, Author
Or you could just turn on the T.V.! Would that help you feel better? lol. Humans need to be getting their news from meditation and then listening to their body-cast (like a podcast). The information from your body is accurate. Use your intuition when reading yourself. We are full swing in up level mode as far as our brains changing so that we are at least at fifth dimensional interaction with each other and the earth. Your body, sleeping, appetite, and general health should be changing drastically for the better. My eyesight has changed, ability to focus, feelings about my body and awareness of what I need to work on. If your focus is still predominantly OUTSIDE of your life and your body you are probably on a downswing physically and emotionally. That’s a choice. You don’t have to go that route.
Our human society has hit a wall and has run it’s course as far as the old DNA lineup. We’re already putting new mechanisms in place that are helpful to the earth and life on it as the old way is dying off. This is a reset point.
Code 0-19; 19:15:10:75
5GForce, 5th dimensional vibe: Red 4 Serpent. I define in order to survive. Measuring instinct I seal the store of life force with the self-existing tone of form. I am guided by the power of birth (Red Dragon is the serpent’s mother). I am a polar kin. I convert the red galactic spectrum.
The two archetypes above represent Planetary Arginine and Valine. We are working on PERFECTING our personal creative vision, focusing and targeting our beliefs about ourselves. What facts do we have in 3D about what we have achieved, learned, and done. What do we feel good about and what don’t we feel good about? Are you done blaming others for something that didn’t go as you wanted it to? There is always synchronicity occurring and everything happens for a reason. What events have happened TO US and what events have happened AROUND US. Those are two very different things. Try to go through that in your head. You may have created a worldview based on what happens to others, not to you. You are not them.
It’s an important distinction because we only create what happens directly to us because our vibe (thoughts and feelings) are a literal magnet. So, while there may be any number of events on a wide spectrum happening around us, we don’t have to respond or be involved in any of it if our soul is not in need of it nor interested in it. I am personally fascinated with human society but when it wastes limited time in the physical with destructive, victim and victimizing behavior on a grand scale I withdraw. That’s not the same thing as feelings being hurt in a one on one friendship or relationship. There is no victimization there.
Time is endless but time in the physical, at this point, is not. IT COULD BE! Speaking of vision, I don’t believe physical death is necessary or smart at all. I know enough about our cells and bodies to know that we don’t have to suffer and die. It’s a special kind of indolence to be caught up in that thought form but just about 100% of humanity believe they have to suffer and die. It’s hard not to be affected by it.
When someone dies that happens to them, not us. We then can respond to what happened to them in any way we choose or need to based on our connection. It doesn’t have to be a terribly negative thing to us when something terrible happens to another. In fact, it’s not helping them if we start to go down the negative tube as well. Try to choose ABOVE the social expectation of joining in the sad sack party. Let them judge you. It will hurt them more than you sitting in their judgment.
This is the 24 hour full themeplex moving from center to the right, then to the left.
We sleep through Blue Eagle and Yellow Seed. This is the unconscious mind
Dawn to noon is the top one. This is Conscious mind flow in the morning. We’re fresh.
Noon to dusk is on the left, also conscious but resistance in the afternoon as humans project onto each other instead of staying centered in their own space.
Dusk to midnight is the bottom. This is subconscious mind of birth family programming. Hopefully, what you just went through during the day enlightens events from your family and YOU RELEASE THEM instead of repeating patterns. The media and politics are able to make quite of bit of headway by programming and using people’s unhealed subconscious mind against them. All of the institutions play on humans child self and pretend they are your authoritative parents. Gag me.
SCIENCE CORNER
This is the full themeplex in order; Blue Eagle is Arginine, Yellow Seed is Valine, Blue Night is Alanine, Red Serpent is Serine and White Worldbridger is Threonine. The last two are posted together above because they literally are almost exactly the same molecules! and then show up in Tzolkin themeplex together. That is a synchronicity between 3D and 4-5D. It happens all the time with this system. That’s why I’m doing this project. Also notice how Valine drops it’s CH3 molecule down to Threonine. That tells me that the Yellow Seed tribe gave it’s “seeds” to the White Worldbrider tribe to help us evolve on Earth
Our DNA IS TIME and I’ve seen it for thirty years. Notice that Threonine has the Carbon atom and two more Hydrogen atoms. The White Worldbridger tribe helped humans escape and survive the Maldek (RED SERPENT which is the GForce today) explosion so when we had to come to earth we needed more carbon and hydrogen to survive. The W WB tribe helped us evolve into that and changed our DNA.
See you tomorrow!
Share this: Intuition UP! Lisa K. Townsend, Author
