Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that. I agree with social distancing but not the masks. Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

Dr. Chavez Brand New Data on Lab Analysis of the Covid19 Sequence. It’s Not Natural, Therefore a Real Vaccine Cannot be Made.


abstract technology science concept DNA binary on hi tech blue background
Fernando Castro-Chavez is with Lambert Dolphin.

9 hours ago

Whatever They Make and Market is  Either Culling or a Placebo. It’s Not Medicine.

Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.

As you skim, please be sure to read the highlighted areas.-Lisa T.

My posting of today at the Research Gate: “By Sørensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical etiology of the SARS-CoV-2 Spike

https://www.minervanett.no/…/13/TheEvidenceNoNaturalEvol.pdf,

This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.

The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte

SARS-CoV-2 is possessed of dual action capability

Simultaneously it is capable of binding to ACE2 receptors

The likelihood of this being the result of natural processes is very small.”

The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”

A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”

Why does this matter?”

“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”

the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved

“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”

“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”

“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”

“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”

“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”

“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”

“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”

“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”

“a designed mutated strain (initially) lacking the furin cleavage site residues was used”

“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”

“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:

1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!

“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”

“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”

“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”

“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!

“typically the objective of gain of function experiments… a strong indicator of manipulation”

“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”

“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!

Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”

“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”

“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.

“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…

“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!

“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!

“we now add here a forensic analysis”!!!!

Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:

“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”

“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”

“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”

Note:

So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!

But the fight continues as follows:

“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”

And the next one is a “classic” of infamy:

“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”

“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.

“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”

“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”

“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”

“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.

“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”

“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.

So, “the reconstructed historical etiology of the Spike (is) as follows:”

“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”

Conclusion
“We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”

Additionally, in this wretched document;

 https://apps.who.int/…/annual_re…/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/…/annual…/GPMB_annualreport_2019.pdf ),

We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”

Sunday. A vision for empowering, commanding, radiant Love, Loyalty, and Heart. White 5 Dog


White 5 Dog; 5 Aspartic Acid

Code0-19: 18:10:5:70

Mediating planet is Mercury which is currently direct.

5GForce; White 9 Dog. Solar, Intention, realization and pulsing of love, loyalty and heart. Get woke!

This is a day for acting and speaking from a flowing open heart that then looks into the mirror guided by clarity, truth, discernment, and commitment. Once that vision is clear from within you, according to your passion and your rational mind, it’s uploaded to Galactic Center Via our Sun.

This it the themeplex today.

I don’t usually use these because I’m not crazy about the art but it does help you see the archetypes and their relationship to one another. The theme is in the center. It’s the nucleus of a DNA molecule. On the right is the analog which is sort of co-equal with the theme and is in the position of the attachment site on the tRNA molecule. Above is the guide power or the D-Arm of the tRNA. On the left is the antipode or the anticodon tRNA on the 3′ and 5′ end of the tRNA. And the hidden wisdom is in the T-arm position. This is my theory. I’m still working on proving it.

The Amino acids analog with these archetypes today are;

  • Aspartic Acid,
  • Methionine, the start codon,
  • Tyrosine, the
  • Stop Codon and
  • Asparagine.

It’s very significant that we have a start and stop codon in the same Tzolkin themeplex. The start and stop codon begin and end the mRNA translation in the sequence. Intuitively, thinking about both the function of the amino acids, their placement, and the attributes of the Tzolkin archetypes, I’d say that the DNA programming of radiant, overtone love from Galactic center is working on flowing and evolving in every nucleus of every DNA cell in every human body today. We need to roll with it, look…in…the…mirror and see ourselves through the eyes of love. Or, see ourselves the way God sees us; as her/his perfect children.

If you are a parent, you know that when your baby is born, they are perfect and you are in love. It was like that for me as a mother and my baby is now 21. I still adore him and want his happiness and health and want him to find the mate he needs and the career he needs to be of service on the planet more than anything else. Now imagine how our Creator feels about us only a bazillion times more. Yes, I see his flaws but forgive them and am patient with them. God’s love IS our love. That’s the only way we have it and it needs to break our hearts open with passion, vision, and forgiveness. We are one human family.

The function of the stop codon, YELLOW SUN, or ZERO is to upload all of that energy like an email to galactic center as a status report. That’s going on right now. From noon-sunset, up it goes. Once we hit dusk it’s Blue 5 Monkey, time to play, relax, hang out until midnight. Happy Sunday.

SCIENCE CORNER