KRSFIEDLLFNKV-The Covid19 Virus general sequence used to make a vaccine…maybe.


abstract technology science concept DNA binary on hi tech blue background

The letters in the title are the single letters that represent the dominant amino acids in the SARS- CV2 virus.We know from Dr. Chavez that the CV2 signature is artificial but the NIH scientists are looking at the natural zoonotic one. I don’t think they are the same. NIH may be lying.

This might be false information again to throw everyone off the track. Remember, they’ve been working on the artificial signature since 2009 and the real questions will be, once the artificial signature is analyzed in light of the Tzolkin how will the vaccine mRNA sequence they have manufactured interact with it?

Since it’s mRNA it can keep mutating. They address that in the link above but not to my satisfaction. This is messenger RNA which is part of the initiation of the RNA sequence.

Q: What determines the mRNA codon?

A: The discussion between the ribosome and the amino acid through the tRNA or transfer RNA which is the Tzolkin Themeplex. They have no clue. My book isn’t out yet.

The tRNA looks like the Tzolkin themeplex and I go into it extensively in my book.

This is 4Leucine∞4Asparigine, 4Valine, 4Tyrosine, 10Glutamine as a tRNA molecule in my opinion. The 3 dimensional image above of the double helix corresponds exactly to the binary triplet configuration I have figured out and have made a huge complex document I’m currently getting into my book that will explain how the G.A.P. kin of the Tzolkin form the ladders that likely are the ribosomes and the double helix may be the sugar backbone. I’m not sure yet. But it all pulses exactly off of the mother’s DNA in the double helix as the Hidden Wisdom or subconscious mind everyday.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7151553/

It boils down to this. Note that there are 13 Amino Acids in the Sequence the NIH gives us. If only the scientists understood the application of the 13 Tones of Creation it would revolutionize genetics.

I’m breaking down the sequence from the TITLE above

  • White Wizard is K or Lysine – 1st appearance
  • Blue Eagle is R or Arginine
  • Red Serpent is S or Serine
  • Red Earth is F or Phenylalanine
  • Blue Hand is I or Isoleucine These two
  • Yellow Human is E or Glutamic Acid are analog
  • White Dog is D or Aspartic Acid
  • Yellow Star is L or Leucine
  • Yellow Star is L or Leucine
  • Red Earth is F or Phenylalanine
  • Blue Monkey is N or Asparagine
  • White Wizard is L or Lysine—Last appearance
  • Yellow Seed is V or Valine

It turns out this sequence is found in all zoonotic origin coronaviruses and it is very bare bones, no start or stop codons nor the rest of the 20 amino acids.

Zoonotic means we evolved from animals and ARE animals. This is no big news. The big news that they are not specking out is the artificial sequence which I already have. What is the agenda behind the creation of the artificial signature?

Note that the sequence begins with the White Wizard and Ends at #12 with the White Wizard and then is SEEDED into the ground via Valine or the Yellow Seed Tribe.

I may add more to this or I may not. The link above is very long and involved but I’m not sure I trust it.

Lisa T.

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.

Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

%d bloggers like this: