The Artificial Covid19 Sequence Will Likely be Unsuitable For a Vaccine. By Dr. Fernando Castro Chavez.


Dr. Chavez is currently working with the 2008 Nobel Laureate Luc Montagnier, the founder of the HIV retrovirus, on fleshing out the true nature of the Covid19 signature and he’s my friend. In between his important work I’ll get his attention, which I already have somewhat since he is familiar with the Mayan system as well and we are on the same page as we talk. Much of his work has fueled my project and I’m very grateful. -Lisa T.

“To the current director of the NIH:

As a Postdoctoral student of Molecular Biology, my focus has been on analyzing the sequence of the current COVID-19. It is so alarming to find the artificiality within it, that I have written to NIH director Frances S. Collins, entitled “A Vital Letter On The Preservation Of Humanity As We Know It”:

Dr. Collins,

As I have had the blessed confidence to write to a brother in Christ since day one, I am sending you this important message. With my best regards,
Fernando Castro-Chavez, PhD.

P.S:
I could not fit this vital link into the letter that independently exposes the hoax imposed on humanity 19 years ago. Let us do all we can to prevent this from happening again but on a wider scale.

AT LEAST SIX RESEARCH GROUPS HAVE FOUND HIV INSERTS IN SARS-CoV-2

Sir,

Prompted by this article: Jun 25, 2020 – Health: The NIH claims joint ownership of Moderna’s coronavirus vaccine: https://www.axios.com/moderna-nih-coronavirus-vaccine-ownership-agreements-22051c42-2dee-4b19-938d-099afd71f6a0.html (https://archive.vn/TArE3), I write to you, saying that we had a deep respect for you (my sister, my girl companion and my peers). The first letter I wrote to you was about Creation, in 2000, just having arrived from my country, written in bad English at least I was willing to live the American dream!!!

Then, we saw you in person and introduced ourselves. You went to the BMC to give a speech about The Human Genome Project, I remember that you said something like: “Mendel is also there, in this slide, right there at the corner…”; then I wrote about our dreams to pursue, not only this Postdoctoral couple of jobs in Medicine but also an MD Career. We two are starting again from scratch. Dreaming to be truthful and to really help humanity… However, now, I dedicate myself to you my current findings, humble, but nonetheless, they are still findings:

1) “COVID-19: AATGGTACTAAGAGG (NGTKR) = HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene (GU455503)”. Finding also done by:

2) Shi Zheng-Li, from the WIV at Wuhan and co-author of Ralph Baric. She distinctively calls it an “INSERTION” (she puts it as GTNGTKR, GGGACCAATGGTACTAAGAGG, adding other two more, but skipping the key one: The Furin Site!), whose putative function is immunosuppressant, as she says that those INSERTIONS have: “sialic-acid-binding activity”, at Zhou, P., plus 27 et al & Zheng-Li Shi.A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020:579:270-73, & 16pp: https://www.nature.com/articles/s41586-020-2012-7.pdf; a third group that found these unique INSERTS is that of:

3) Sørensen (identical to the previous one: GTNGTKR, but also studying, to leave no doubts, its functional span by performing 6 by 6 NT iterations containing our sequence of interest (and of many others), such as VSGTNG, SGTNGT, TNGTKR, NGTKRF, etc.), who says in an interview, as he found many more INSERTS (saved at https://archive.vn/7TPTc): “The INSERTED sequences have a functionality that we describe.

We explain why they are essential: …accumulated charge from inserts and salt bridges are in surface positions capable of binding with cell membrane components other than the ACE2 receptor.” This statement is very important and indicates that if we realize that this virus is NOT natural we could be and could have been better prepared since the start to fight against it in a more logical, rational, and prepared way, which did not happen. The artificiality of the virus also makes it unsuitable for vaccination, instead of the opposite, because that is the way the human tampering of nature works. The attempted purpose of its design is to do one thing, and it happens to result in just the opposite thing than what was wanted: “…the naked coronavirus spike protein as a concept for the basis of a vaccine, which we have rejected because of a high risk of contamination with human-like epitopes.

Analysis of the Spike protein of SARS-CoV-2 shows 78.4% similarity with human-like (HL) epitopes…” and “… A search so tailored to match against all human known proteins will give a 78.4% human similarity to the SARS-CoV-2 Spike protein, i.e. if all epitopes on the 1255 amino acid long SARS-CoV-2 Spike protein can be used by antibodies then there will be 983 antibody binding sites which also could bind to epitopes on human proteins…”The original article delving into all of those technicians is: Sørensen, B., Susrud, A. and Dalgleish, A.G. Biovacc-19: A Candidate Vaccine for Covid-19 (SARS-CoV-2) Developed from Analysis of its General Method of Action for Infectivity. QRB Discovery (by Cambridge University Press) 2020:17 pp [Accepted Manuscript]: https://doi.org/10.1017/qrd.2020.8.

This important article clearly indicates that if we do NOT realize the real origin and the real nature of this virus, we will continue to be deceived as per its treatment and its strategies of attack, and will be responsible for having on purpose dimmed the light of its artificial origin. Especially when we all are aware that the authors of “The Proximal…”, Andersen et al. Nat. Med. 2020 article have been written by reefers that have ever been used for political purposes rather than scientific ones.

So, apart from as these three independent findings of that and many more related HIV sequences, we have another two sets of witnesses, totaling FIVE independent groups finding this: Mine, Zheng-Li’s, and Sørensen’s, but also:

4) Pradhan, from the Indian group that was forced to withdraw its article, who calls the contained sequence under consideration as the previous ones: “INSERT 1″: TNGTKR, elongating the set of meaningful nucleotides as TCTGGGACCAATGGTACTAAGAGG (SGTNGTKR): Pradhan, P. et al. Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag. Biorxiv 2020: 14 pp. (Withdrawn, 128 comments): https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1, they start describing their findings as follows:”We found four new insertions in the protein of 2019-nCoV- “GTNGTKR” (IS1)…”, but this is not all, but also a fifth group, being this the one integrated by:5) Perez and Montagnier (2008 Nobel Prize in Medicine, precisely for his discovery of the HIV virus), and they describe our found sequence within, together with a couple of tens more: TCT GGG ACC AAT GGT ACT AAG AGG TTT GAT AAC CCT G (SGTNGTKRFDNP…, finding them in here, fragments of SIV joined to the HIV-1A that I found, and sown in point “1”), from these sequences found by them, they start and end their meaningful conclusions, coming from the wisest of men, as follows:1) 18 RNA fragments of homology equal or more than 80% with human or simian retroviruses have been found in the COVID_19 genome;

2) These fragments are 18 to 30 nucleotides long and therefore have the potential to modify the gene expression of Covid19. We have named them external Informative Elements or EIE;

3) These EIE are not dispersed randomly, but are concentrated in a small part of the COVID_19 genome… …everything converges towards possible laboratory manipulations which contributed to modifications of the genome of COVID_19, but also, very probably much older SARS, with perhaps this double objective of vaccine design and of “gain of function” in terms of penetration of this virus into the cell. This analysis, made in silico, is dedicated to the real authors of Coronavirus COVID_19. It belongs only to them to describe their own experiments and why it turned into a world disaster: 400 000 lives, more than those taken by the two atomic bombs of Hiroshima and Nagasaki.

We, the survivors, should take lessons from this serious alert for the future of humanity. We urge our colleagues’ scientists and medical doctors to respect ethical rules as expressed by Hippocrates oath: do no harm, never and never!”; an earlier manuscript of them can be found at Perez, J.-C., and Montagnier, L. COVID-19, SARS and Bats Coronaviruses Genomes Unexpected Exogenous RNA Sequences. ResearchGate & OSF 2020:43 pp. [Older Manuscript]: https://osf.io/d9e5g/download/?format=pdf.

I started my letter saying that I used to have respect for you. However, the standing taken as to ignore the real origins documented by these five research groups and by countless others, of the whole pre-planning of the current Pandemic by COVID-19, has made me change my current opinion about you.

6)Arumugham also discusses such “Artificial selection at work… via recombination with HIV-1 derived inserts and selecting the viruses for efficient human kidney cell infection”, and my comment is again that to notice this artificial origin of COVID-19 is very important to do the proper treatment to patients, and to prevent another thing like this from emerging out of a Gain of Function “research”: Arumugham, V. Root cause of COVID-19? Biotechnology’s dirty secret: Contamination.Bioinformatics evidence demonstrates that SARS-CoV-2 was created in a laboratory, unlikely to be a bioweapon but most likely a result of sloppy experiments. Zenodo 2020:9 pp. (Manuscript saved at: https://archive.vn/N79Ci): https://zenodo.org/record/3766463#.Xuu9RTpKjIW

My experience on finding human artifacts on genomes dates back to the EcoRI palindromic linker that is contaminating thousands of sequences in the Genbank: Castro-Chavez, F. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes. DNA Cell Biol. 2012, 31(2):151-63: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3272245/

The freedoms of the whole humanity are at stake and the good God The Creator that you deeply respect, has put you in a key position as to be able to revert as soon as possible the current decline of the human values, and of the human nature in general, and this all because of a deliberate release of the current Sars-CoV-2. 9/11. It was the first False Flag Operation aimed at stealing as many freedoms as possible from the human race, and the Fake Anthrax Attack of 2001 had the same purpose, releasing a pre-planned and the very anti-patriotic document called the “Patriot” Act, which also included an immunity clause preventing the Pharmaceutical Industry of even more liabilities, but it was contested by the population, and it was removed. So, I wish to stop the GoF initiatives.

Here we are today, contesting the “official” narrative of the current Plandemic as we did in the past with the “official” narratives of 9/11 when we discovered nano-bombs and fake planes injected into the TV screens. I expect to publish this letter out in the open after you have read it. Only history will tell if TRUTH was able to win on this time over darkness, or if the criminals will get away once more… With my same thinking as at the beginning of the current letter (but praying that this could very soon change),

Fernando Castro-Chavez, PhD.

P. S.

My ongoing work can be found at the ResearchGate. While many pieces of it have been removed from Facebook and from the YouTube by some heartless and brainless censors appointed by the WHO and by their owner, Bill Gates, apparently the mastermind, chosen by the globalists to pull this event of an artificially manufactured viral harm for the whole of humanity, it is there. But as Mordechai told to Esther: “If you do nothing about it, God will raise somebody else to redeem us of this plague, because our clamors for freedom and for justice have already reached the Heavens”. Jesus said that it will not be so easy for the believers to overcome evil in the current times, but that it could be possible. As Christian believers, we believe that as long as we continue over the earth, the total fruition of the plans of darkness can NOT prosper, and you may be a key member of the Body of Christ in order to fulfill such restraining against the forces of evil of this world. Thus far, the next are some of the sequences that seem to be inserted (some of them seem to have been started to be tampered with since the RaTG13 “experiment” of Shi Zheng-Li, a genome she had since 2013 but that she did not publish until 2020 after the first Sars-CoV-2 had been published in China, a genome that of the RaTG13 (previously published in part twice with different names that included the number 4991.

That is dishonesty in science to change the names of the sequences, and that is what Shi just did!). It has been used, ironically, even with all its methodological anomalies, to precisely attempt to undermine the artificiality of the inserts. Even two sequences published earlier by the Chinese Military seem to have been already tampered with to make them more infectious. This is what happens when you only have the sequences provided by them with nobody else corroborating their authenticity), so, I may use the “probable” inserts clause, mostly from HIV-1, some few from HIV-2 and one from SIV (as explained by Perez & Montagnier, 2020).

So, the number of artificial sequences is growing as research progresses, that is why, when people try to discredit some of these from being artificially made, the burden is over them to explain how all of them got INSERTED into one same viral genome, which may have required the same animal cell with multiple different viruses and even bacteria exchanging only the specific required portions and no more, which is something naturally implausible but completely possible within a lab setting. (then I add here the list from my previous posting in response to Jennifer Clarkson, adding that there, (most of those sequences are concatenated sequences).”I have also added here my last comparison of the sequences found in Nsp3 by A. V., highly specific both to COVID-19 and to HIV-1.

*The link by hero Robert F. Kennedy Jr. denouncing the big conflict of interests in which the NIH is involved: https://www.instagram.com/p/CCAcwVkHCec

*And this Fourth of July, I present here some of the current sounds of my dear nation: https://archive.vn/THJ2h, https://ourrescue.org/, https://qmap.pub/ (saved at, as per today: https://archive.vn/Us7O8)…”

: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031— with Karen Wierwille Martin.

In the Matrix, What We Call Coincidence is SYNCHRONICITY


The top right picture is Bell Rock in the Village of Oak Creek, AZ. I used to live there and hiked all around that vortex. It was very electric and upward flowing so it wasn’t my favorite, but I am very familiar with the area.

It is crazy to look at our marble blue ball called earth and realize we are all little ants on the back of GAIA running around having fits and making a mess. She would like it if we’d sit still once in a while and get synchronized to HER cycles and clean up after ourselves. If nothing else, this plandemic has made people sit still.

Tomorrow is Full Moon Lunar Eclipse in Capricorn. Organization and self-discipline are on tap. Watch for epiphanies given to you via synchronicity. Saturn is the mediating planet for Yellow Warrior and Blue Night.

Synchronicity is organized math applied to human intentions, thoughts, feelings, and contracts with other entities to learn soul lessons. You can actually stay on the planet as long as you want if you program your mind and belief to the truth of timelessness.

Aging is defined as cellular stress. We have 100% control over our mental stress state. There are scads of ways to stay in your own vortex, focus on your own body and control your physical life apart from the group programming rife in the media and all around us.

It takes navigation. If you follow others flight plans and internalize the group think flight plan you will traverse the road that they all follow by default; define yourself by your linear age, truly believe that your body is destined to decline (it’s not), get sick, suffer, die and be buried.

Today is Red 6 Rhythmic Earth and it’s all about keeping a beat to your own internal rhythm. If you follow the social beat you will decline because it’s not your biorhythm but a group biorhythm programmed for the group FOR PROFIT for the elite to feed their industries. Humans are fodder to them. They have an endless amount of distractions to pull your mental focus off of all the grand creative and timeless energy you have as a beautiful soul so that you’re giving your mental and emotional energy to them. It’s a hungry 3 headed monster that hopefully will be dispelled with Disclosure at the Federal level. They eat their young. It’s actually already happening.

This programming is largely unconscious by the majority of people because we deem it “normal” to do what everyone else is doing. In fact, we don’t want to miss out. Why? Because it’s your God. You don’t follow the God of your body, your own timing, breath, and inclination. You follow what everyone else is doing because it feels safe. If you didn’t, it would be weird, they’d call you names and people would stop liking you and the opposite sex would want to stop having sex with you. Not.

There are millions and millions of us who are not followers but are on a spiritual synchronicity path that gives us the healthiest, highest quality of life of anyone on the planet. We live in tune with the cycles and ourselves. We all have a different names for God or Source but we know “they” are real. They are one with us.

You begin to see this internal source through observing synchronicity around you. The attributes of Red Earth are; evolve, synchronicity, navigation, tracks clues, grounds, collects synergy, governs earth force, shields, earth keeper, crystal healer, liberal, and confident. Understanding the Tzolkin Harmonic will tune you up to be able to see the synchronicities, feel them and wake you up!

MOLECULAR LINE-UP FOR THE THEMEPLEX

Isoleucine and Valine look identical to me so that’s synchronicity. Notice the Saturn hexagon in phenyalanine.

The mediating planet is Uranus which rules Aquarius. The 5th dimensional GForce is Blue 8 Night; Galactic dreaming and abundance.

Self-Existing Vision, Which You Won’t See If You’re Looking at What Everyone Else is Looking At


Tone 4 is Self-Existing

The word “wrong” is a bit judgmental. There is right and wrong in the Universe but it usually applies to math only in an absolute sense. Almost everything else is relative to the outcome you’re seeking. That’s why there is no judgment no matter what anyone accuses you of or what you accuse them of. There is discernment though about a person’s character based on THEIR ACTIONS, not their words. Talk is cheap.

Do you know what outcomes you’re seeking in your own life? What are your unique traits and visions that you would need to work on to manifest? Do you have a vision for yourself? We can put in a request for our vision “for humanity” but we have no control over THE GROUP. Our biggest power is over our own bodies and minds. It’s ironic that that is the first thing we hand over to people we think are bigger, stronger, richer and more powerful than we are. They aren’t. They actually rely on us giving over our heart and minds TO THEM. That’s what politics and T.V. are all about; both parties. If you show or tell them that you’re not interested in handing anything over to them they will respect you and stop expecting you to obey them. Too many people are afraid of community police, leaders, and politicians. They’re JUST people who many times have done quite of a bit of lying to get where they are. They aren’t that powerful. The biggest power is to sitting in authenticity in your truth. It’s very rare. Artists do it and we are at the fringes of society because of it.

The Tzolkin archetype today is Blue 4 Eagle. It’s about measuring, forming, and defining our thoughts, ideas and visions. There energy is there for it today. Tone 4 is like a potter at the wheel or a music composer working on a score. How is it taking shape? Does it look the way you’d like it to? Eagle kin are independent, committed, artistic, compassionate, exacting, visionary, and technically inclined.

The mediating planet today is Jupiter for Blue Eagle tribe and that is in synchronicity with the Moon in Sagittarius. Jupiter rules Sag. Pluto aligns with Pallas and Jupiter tomorrow. We’re willing to invest our energy into solving problems and we can be determined to get to the truth of a matter. Avoid pushing your hatched ideas onto others. Sit with them quietly in yourself!

The 5D GForce is Red 10 Serpent which is curious at this point. I believe we are done with the karma of Maldek governing Serpent and Wizard so there may be a significant biological change with the amino acids Serine and Lysine in our bodies collectively. That is one to watch.

I perfect in order to survive. Producing instinct I seal the store of life force with the planetary tone of manifestation. I am guided by the power of space. I am a polar kin. I extend the red galactic spectrum

MOLECULAR LINE-UP IN THEMEPLEX

  • Blue Eagle in the center is arginine
  • Yellow Seed on the right is valine
  • Blue Monkey above i aspragine
  • Red serpent on the left is Serine whose molecule is almost exact with
  • White Worldbridger on the bottom.

Humans are at Their Best When They Take Care of Themselves and Then Unify; Tone 1


Unity doesn’t mean gentrification, uniformity, or agreement. Unity can only happen amongst whole people who realize they are naturally whole, not in pieces. Our bodies are not in pieces although the sick-care system talks about our bodies and organizes itself in pieces. There are separate doctors for separate systems or parts that aren’t separate at all! I can’t tell you how many patients have been on my table, I’m working on their neck or something in the upper body and they say, “I just felt that in my hip”. The CNS or central nervous system, which are the brain and spinal cord, UNIFY the entire body. In a split second, anything you think or feel causes some cellular action anywhere in the body. Standing up and walking is a perfect example. You thought of it, felt like doing it, and then your feet executed the action. That is holism in action. Just because you have a stomach ache doesn’t mean you won’t feel it in your head. Anyway, it’s literal energy. You either ran some very negative energy (negative emotion) or some toxic person just threw it at you. It causes a physical manifestation.

Humans become magnetic and focus when they have strong boundaries that honor who they are, what they came to the planet to learn and achieve and rely on themselves more than other people. We are called to TONE 4, to be self-existing so that when TONE 12 comes around, the crystal round table, we can truly be communal and not so conflictual which is projecting our own unresolved issues onto each other when in truth, we need to remedy that inside ourselves, by ourselves!

Tone 1 is magnetic. It’s the beginning of new vibration and needs to stabilize as it polarizes and moves to Tone 2. The human race has been evolving through the 20 amino acids as the 20 tribes of time, and 13 Tones of Creation for millions of years now. We’ve done it through 2 strand DNA that mirrors itself. I am told we are about to jump up to 12 strand DNA as we process the new universal information from 5D. That coincides with the 12 chakras in the body as well. There is a worldwide meditation tomorrow to open the Age of Aquarius which will hasten this activation. Humanity needs to do it EN MASSE. Studies have proven how powerful this is. I’ll post on that next.

Some…humans will participate in the millions. But we are a planet of 7.5 billion people as of 2018. It would be nice to get 10% or 750 million people participating in this. The leaders and the lightworkers will. The rest of humanity is still deciding how to process and accept the Covid19 virus into their body/brain, take the mask off and uplevel instead of dying. I accept it I just don’t need to do it. I already did it and it changed me. Before anyone even knew about CV2, my Spirit Guides told me I was a DNA Node or Nade and that I would have a wide influence over my region via my physical presence and via communication if people allowed it. I’m here to serve and I am a lightworker. It opened WIDE my pineal gland and it wasn’t easy but for cripes sake, you don’t have to die or fear it unless in truth, you have no spiritual awareness or belief at all. You might want to get right with Source in your heart before you expose yourself to it. We all have toxins in there that need to come out. That’s the purpose of the virus. Our pineal glands (3rd eye in the forehead) and our crown chakras were NEVER MEANT TO BE CLOSED. That’s another story for another post.

The 5GForce for today is Yellow 13 Star;

I endure in order to beautify. Transcending art I seal the store of elegance with the cosmic tone of presence. I am guided by the power of free will.

MOLECULAR LINE-UP

We have the interesting correlation here between isoleucine and methionine, the start codon on the left side chain; the Hydrogen/Carbon molecules, 3 each. But then moving right, methionine has sulphur, the ancient original chemical that started evolution on earth and then the carbon and hydrogen it it’s place in isoleucine.

This themeplex is the molecular picture of early human evolution; Yellow Human, Blue Hand, White Wind, and Red Moon. The Yellow Human Tribe with the support of Blue Hand helped to cultivate and civilize earth for a new species of humans. Their challenge was communication (White Wind) and their hidden wisdom was Cosmic self-remembrance, in tune emotionally. Archeological evidence shows early humans were profound ARTISTS! they weren’t primitive at all. They were very advanced.

Friday Starts Out Calm But It Likely Won’t End That Way. Red 11 Moon.


The Moon and Water are intimately intertwined

We have a moon in Virgo today as exact synchronicity. Meaning, OUR moon, right next to the earth, is placed in Virgo. Today is the Tzolkin archetype Red 11 Moon and it’s mediating planet is Mercury (in retrograde) which rules Virgo and Gemini.

This isn’t causing communication tech snafu today but the release of true feelings and thus some chaotic storm. The earth may throw a fit today as well as some humans. But because we have the White 11 Dog analog supporting the situation it may be fine.

I’m getting a lot of busy work done that had to be fixed and have no time for dawdling. That’s Virgo energy; taking care of details and focusing.

The attributes at play today are; purify, flow, universal water, love, loyalty, and heart, catalyze, energy self-generation, influence, wisdom, and free will. Overarching all of that is 11 Tone of Creation or SPECTRAL energy. That is releasing, liberation, and dissolving. It also means ghosts so think of dissolving one energy body into another which happens at death naturally.

This is happening emotionally for people right now as we continue to process the eclipse and the paradigm shift we’re in. People are deciding whether to SELF-generate or to allow TV/Government/Church/Sickcare generate for them for money and someone controlling them so they don’t have to put in the effort. This is the choice the whole human race is making right now.

The lesson of Blue Storm is that we create our own experience of storms, sunsets, sunrise, our own peace after a storm, etc. It’s all self-generated in our body by our mind so THERE ARE NO VICTIMS. Everyone on earth has victimization attempted on them but then you get to choose whether to internalize the energy and let your character be defined by that as a truth foisted on you by someone else or whether you want to overstep the perpetrator and empower yourself. The universe has your back and you absolutely have the final say over your own soul and body.

Each person on the planet has been given FREE WILL (Yellow 3 Human) to focus their mind on behalf of themselves and create the mind, body, and life they want. They just have to do it and stop wasting their energy blaming everyone else or waiting for someone to make them happy. It’s a terrible virus.

I’m not saying humans aren’t wrong most of the time. We are. But that’s how it is on Earth. We’re all learning. Still, can you imagine what kind of world it would be if everyone loved themselves and minded their own business!? Then we could actually share unconditionally with one another and learn quicker instead of getting in each other’s way.

MOLECULAR PERSPECTIVE

Methionine is Red Moon, Aspartic acid is the analog; White Dog, and the antipode is Tryptophan; Blue Storm. There is the daily synchronicity between the analog support and the hidden wisdom. That is a very calming influence I’m happy to say. Those two molecules are almost identical.

Imagine Having a Cosmic Mirror…


This is a real picture of a mirror’s reflection.

Our mediating planet is Neptune. It’s dreamy and visionary. We’re combining that with the Moon in Aries and a creative aspect between Saturn and the Sun. This is serious energy to get some creative work accomplished…finally. However, the Moon squares Jupiter later so we may not have made a concrete decision yet about what direction we’re headed.

The 5GForce is White 1 Wind in synchronicity with our Guide Power and it adds up to 14 which is Occult so there is more being revealed that was hidden today. Be sure to be tuned in, daydream, journal, meditate, create. There is big information afoot to be gleaned.

White Mirror attributes are; Reflection, Order, and Endlessness (Neptune and Saturn!). Mirror is pure, faces the shadow, is self-sacrificing a discriminator, ritualistic, disciplined, has the sword of wisdom, is well coordinated, has clarity, timelessness, and is practical and meditative.

We are looking at 13 Tyrosine in the DNA nucleus of the molecule with 13 Cysteine as it’s analog. As tRNA we see 13 Glycine, as antipode 13 Leucine and as Hidden Wisdom 1 Alanine. It spins to the left in our cells.

SCIENCE CORNER

The hexagon of Saturn is seen there in the Tyrosine molecule so Neptune and Saturn have something symbiotic. Notice the loaded carbon in Leucine which was an essential A.A. in our evolution for the formation of our muscles. And what is the meaning of Alanine and Glycine almost being identical? They are the guide power and Hidden Wisdom today. With the extra Carbon and Hydrogen atom in Alanine, it is indeed magnetizing or grounding our VISIONS from galactic center.

Saturday. Dissolving Walls with Histidine


Histidine is an amino acid that is responsible for tremendous bursts of energy from every cell in our bodies. With it’s analog Alanine, it affects the function of our muslces. It’s a survival, thriver amino acid that has allowed the human race to accomplish amazing feats and is tied to our cortisol levels which affects energy level.

SCIENCE CORNER

Effects of Histidine and β-Alanine Supplementation on Human Muscle Carnosine Storage

Carnosine is a di-peptide molecule, made up of the amino acids beta-alanine and histidine. It is highly concentrated in muscle and brain tissues. Carnosine and carnitine were discovered by Russian chemist Vladimir Gulevich.

https://pubmed.ncbi.nlm.nih.gov/28106620/

Also in this themeplex we have White Worldbridger or Threonine as the antipode and Red Serpent or Serine as the Hidden Wisdom. There is an amazing amount of carbon in all of these molecules which helped humans evolve flesh onto our bones.

These molecules have very strong synchronicity with each other which is another sign that their line-up in the Tzolkin Harmonic Code is connected to our lives on earth. Through a binary triplet configuration and the 13 Tones of Creation, these 3D proteins fold into everything in our world. Once the scientists accept that what is esoteric underpins the nature of things, this information will be tested and processed to create a real healthcare system with a philosophy of Whole systems.

FRIDAY Daily Tzolkin Reading to get Your Vibe Lined Up!


Or you could just turn on the T.V.! Would that help you feel better? lol. Humans need to be getting their news from meditation and then listening to their body-cast (like a podcast). The information from your body is accurate. Use your intuition when reading yourself. We are full swing in up level mode as far as our brains changing so that we are at least at fifth dimensional interaction with each other and the earth. Your body, sleeping, appetite, and general health should be changing drastically for the better. My eyesight has changed, ability to focus, feelings about my body and awareness of what I need to work on. If your focus is still predominantly OUTSIDE of your life and your body you are probably on a downswing physically and emotionally. That’s a choice. You don’t have to go that route.

Our human society has hit a wall and has run it’s course as far as the old DNA lineup. We’re already putting new mechanisms in place that are helpful to the earth and life on it as the old way is dying off. This is a reset point.

Code 0-19; 19:15:10:75

5GForce, 5th dimensional vibe: Red 4 Serpent. I define in order to survive. Measuring instinct I seal the store of life force with the self-existing tone of form. I am guided by the power of birth (Red Dragon is the serpent’s mother). I am a polar kin. I convert the red galactic spectrum.

The two archetypes above represent Planetary Arginine and Valine. We are working on PERFECTING our personal creative vision, focusing and targeting our beliefs about ourselves. What facts do we have in 3D about what we have achieved, learned, and done. What do we feel good about and what don’t we feel good about? Are you done blaming others for something that didn’t go as you wanted it to? There is always synchronicity occurring and everything happens for a reason. What events have happened TO US and what events have happened AROUND US. Those are two very different things. Try to go through that in your head. You may have created a worldview based on what happens to others, not to you. You are not them.

It’s an important distinction because we only create what happens directly to us because our vibe (thoughts and feelings) are a literal magnet. So, while there may be any number of events on a wide spectrum happening around us, we don’t have to respond or be involved in any of it if our soul is not in need of it nor interested in it. I am personally fascinated with human society but when it wastes limited time in the physical with destructive, victim and victimizing behavior on a grand scale I withdraw. That’s not the same thing as feelings being hurt in a one on one friendship or relationship. There is no victimization there.

Time is endless but time in the physical, at this point, is not. IT COULD BE! Speaking of vision, I don’t believe physical death is necessary or smart at all. I know enough about our cells and bodies to know that we don’t have to suffer and die. It’s a special kind of indolence to be caught up in that thought form but just about 100% of humanity believe they have to suffer and die. It’s hard not to be affected by it.

When someone dies that happens to them, not us. We then can respond to what happened to them in any way we choose or need to based on our connection. It doesn’t have to be a terribly negative thing to us when something terrible happens to another. In fact, it’s not helping them if we start to go down the negative tube as well. Try to choose ABOVE the social expectation of joining in the sad sack party. Let them judge you. It will hurt them more than you sitting in their judgment.

This is the 24 hour full themeplex moving from center to the right, then to the left.

  • We sleep through Blue Eagle and Yellow Seed. This is the unconscious mind
  • Dawn to noon is the top one. This is Conscious mind flow in the morning. We’re fresh.
  • Noon to dusk is on the left, also conscious but resistance in the afternoon as humans project onto each other instead of staying centered in their own space.
  • Dusk to midnight is the bottom. This is subconscious mind of birth family programming. Hopefully, what you just went through during the day enlightens events from your family and YOU RELEASE THEM instead of repeating patterns. The media and politics are able to make quite of bit of headway by programming and using people’s unhealed subconscious mind against them. All of the institutions play on humans child self and pretend they are your authoritative parents. Gag me.

SCIENCE CORNER

This is the full themeplex in order; Blue Eagle is Arginine, Yellow Seed is Valine, Blue Night is Alanine, Red Serpent is Serine and White Worldbridger is Threonine. The last two are posted together above because they literally are almost exactly the same molecules! and then show up in Tzolkin themeplex together. That is a synchronicity between 3D and 4-5D. It happens all the time with this system. That’s why I’m doing this project. Also notice how Valine drops it’s CH3 molecule down to Threonine. That tells me that the Yellow Seed tribe gave it’s “seeds” to the White Worldbrider tribe to help us evolve on Earth

Our DNA IS TIME and I’ve seen it for thirty years. Notice that Threonine has the Carbon atom and two more Hydrogen atoms. The White Worldbridger tribe helped humans escape and survive the Maldek (RED SERPENT which is the GForce today) explosion so when we had to come to earth we needed more carbon and hydrogen to survive. The W WB tribe helped us evolve into that and changed our DNA.

See you tomorrow!

Thursday. White Solar Wizard; Lysine is Evolving but we are in a Conflictual Harmonic in 3D


6.  Sung / Conflict-3D designation only

☰above CH’IEN  /  THE CREATIVE, HEAVEN
☵below K’AN  /  THE ABYSMAL, WATER

Code0-19: 19:14:9:74 (The 19th harmonic, the 14th archetype, the 9th tone and the 74th kin. A full Tzolkonic count would be 65:20:13:260 at the end of a 260 day spin.

The mediating planet today is Malkek or Tiamat which is now the asteroid belt in our solar system. Notice it’s position in relation to The Sun in the center, our little earth and Jupiter.

The attributes afoot for the entire themeplex are; Tone 9 is solar which realizes and pulses intention, that is if the humans corral their minds and FOCUS on setting their intentions for themselves. White Wizard brings enchantment, receptivity and timelessness. They are heart-knowing shamans and concerned with spirituality. Attributes of the other kin are; survival and instinct, love and loyalty, focus and awareness, and healing accomplishment.

In themeplex with White Wizard are Red Serpent, White Dog, Yellow Seed, and Blue Hand which are very grounding for these kin. Their mediating planets are also right next to the asteroid belt and in the image above. Red Serpent is the asteroid best, Yellow Seed is Jupiter, and Blue Hand is the Earth. Indeed, after Maldek blew up the Skywalkers and Worldbridger kin brought the refugees of Maldek to Earth. It wasn’t a far journey. You can find the details of these kin in the app at this link; http://www.another-world.net/MobileSoftware.

SCIENCE CORNER

Here are the rest of the amino acids in themeplex;

Notice that VALINE and ISOLEUCINE are almost identical but isoleucine and valine are ketogenic and glucogenic. They are both BCAA or branched chain amino acids.

This scholarly article gives a more in depth evaluation of the interesting relationship between Valine and Isoleucine.

https://pubmed.ncbi.nlm.nih.gov/24301972/

Monday; The Amino Acid Asparagine Evolving


Code0-19; 18:11:6:71

Mediating Planet; VENUS

Attributes of this gateway: We’re balancing equality and organizing through play, illusion, and magic. Tricksters, jokers, and mischief is afoot and it’s not always funny. It’s supported by clever art, sometimes inspirational. We’re guided by our own nature and challenged by the nature of our birth family who are different than us. This is called blood memory and while an influence, should not control our destiny. Our hidden wisdom is integrity and harmony with GALACTIC love and loyalty, our universal family, not just our earth family. One true friend is worth a thousand family members.

Tzolkin archetypes; Blue 6 Monkey, Yellow 6 Star, Blue 6 Monkey, Red 6 Dragon, White 8 Dog

Amino Acids evolving; Asparagine, Leucine, Asparagine, Cysteine, and Aspartic Acid

5GForce: Red 8 Moon which is galactic flow of feelings. While acknowledging what human cultures like to squabble about, it’s important to flow at a higher level and be done with PETTY human differences and focusing exclusively on them. We care about the character, behavior, actions, and creativity of individuals and find no solace in making a point about gender or skin color if that’s all we were raised with. Not everyone was raised in a cultural bubble and needs to keep beating that drum so don’t expect or bully them to do so to justify your need to.

SCIENCE CORNER

I notice that all 5 Amino Acids in this gateway have the exact same element line up on the right; O, OH, and NH2. Leucine (Yellow Star) has more carbon and Yellow Star kin are far more earth/muscle bound. Our bodies are mostly carbon. Cysteine has the sulfur molecule and indeed Red Dragon tribe was the first group to start evolving here.