The Sun’s Movement Creates the Interplanetary Holon; Destiny Kin and Analog are One.


https://www.forbes.com/sites/startswithabang/2019/01/01/this-is-how-the-sun-moves-in-the-sky-throughout-the-year/?sh=5f56f1d87303

This is a fabulous article showing how Our Sun moves in a lemniscape pattern (infinity symbol) from the vantage point of earth.

For instance, today is Blue 10 Planetary Monkey or in 3D DNA, Planetary Asparigine. Its analog is Yellow Planetary Star or Planetary Leucine in DNA. Venus is the mediati g planet.

Remember this? Try to memorize it.

These kin are eternally supportive of one another. Imagine an infinity symbol straight across between the two kin on either side. Solar-Galactic, tone 8 and 9 are continually attached. Notice tone 8, the number 8 placed on its side is the infinity symbol.

This is the 0-19 Code! The Sun is ZERO in truth. That is something to meditate on. It is tribe number 20 bit in FACT is zero. 0=20 in mayan math.

The Red Dragon is 1 and indeed, in earth history the dragon species were first on the planet and still consider it theirs. A lot of water under the bride bridge there as far as right to territory but suffice to say, just go down the left until you hit Red Moon 9 and cross over to White Dog 10 and go up until you hit Blue Storm 19. This is the HISTORY OF EARTH.

We are currently in a HUGE BLUE STORM self-generating cycle and if you follow this blog you know there has been tremendous synnchronicity with Blue Storm and we are in a Blue Storm year.

Enjoy this wonderful validation of solar movement with earth according to the universal matrix shown to us by thw magical maya. 🙏🐒⛰

Sunday; Red 9 Solar Earth.Today’s Gateway is governed July 4, 1776, the Signing of the Declaration of INDEPENDENCE.


Ben Franklin, John Adams, and the writer, Thomas Jefferson editing the Declaration.

Before Ben Franklin, John Adams, and Thomas Jefferson edited the Declaration, my ancestors in Norfolk, England, specifically the exchequer for the Crown, Charles Townsend, stirred up rebellion on our soil by trying to tax tea and thus the Boston Tea Party ensued. Yeah, he was a cousin. I quote History.com below.

Townshend Duties

“The Townshend Acts, named after Charles Townshend, British chancellor of the Exchequer, imposed duties on British china, glass, lead, paint, paper and tea imported to the colonies.

Benjamin Franklin had informed the British Parliament that the colonies intended to start manufacturing their own goods rather than paying duties on imports. These particular items were chosen for taxation because Townshend thought they would be difficult things for the colonists to produce on their own. He estimated the duties would raise approximately 40,000 pounds, with most of the revenue coming from tea.

While the original intent of the import duties had been to raise revenue, Charles Townshend saw the policies as a way to remodel colonial governments. The Townshend Acts would use the revenue raised by the duties to pay the salaries of colonial governors and judges, ensuring the loyalty of America’s governmental officials to the British Crown. However, these policies prompted colonists to take action by boycotting British goods.

Charles Townshend didn’t live to see the measures enacted. He died suddenly in September 1767, before the detrimental effects of his signature rules could materialize.”

July 4, 1776. Red 9 Earth
I pulse in order to evolve, Realizing synchronicity I seal the matrix of navigation with the solar tone of intention. I am guided by the power of SPACE or 3D.

The analog today is White 9 Solar Wind and we are currently under the effects of our Great Central Sun’s CME’s and Solar wind stirring the pot before this important election. The wind is blowing fierce here in Michigan. This is a big synchronicity. The people are about to express their wishes for this Republic that has lost it’s Democratic way. I wish it were not so but I am a realist.

We have to re-establish our independence in two days; Blue 11 Spectral Storm, from international human trafficking, the most evil abuse of children beyond what any American imagines, corrupt lawmakers, and a Catholic Church steeped in pedophilia and a possible sponsor of the trafficking. Add to that the normalization of incest in American families and our democracy is being ripped asunder by the abuse and misalignment of the body. Hmmm, who profits from that? Sick-care industry. They’re great if you get into a vehicular accident or fall out of a tree but that’s it.

The Guide Power is Red 9 Solar Skywalker who has the guts to say what no one else will. We are all each responsible for the condition of our body. Genetic Determinism is dead, our lifestyle sets the tone, only we choose what to put in our mouth, and there is no lack of holistic practitioners to choose from who will empower and teach you how to take care of yourself. You just have to independently navigate your own body with their help. You need not be afraid of a virus. You do need to be afraid of your own lack of ACTION on behalf of your own immune system which handily deals with any toxic virus or bacteria if you just shore it up.

The antipode is Blue 9 Hand; knowing, healing and accomplishing. We have a long way to go releasing the programming from media, sick-care and state regarding the lies about how weak and stupid we are. It’s immensely profitable for them to convince us that we have to take marching orders and comply because we’re too weak and dumb to do otherwise. Yeah, that will crack The Republic to its foundation. Then the addiction to alcohol and opiates starts.

The Hidden Wisdom is Yellow 5 Overtone Seed. It’s time to set a radiant focused intention or target to germinate in the blessed dark up until Winter Solstice, December 21, 2020. That’s a big day for all of us. Many things will be released.

The Fifth Dimensional GForce is Blue 5 Overtone Night. There is the Radiant Dark of Night of which I just spoke. It’s the dimensional soil that will germinate the radiant seed. But we have to do it.

Keep it simple. FOCUS on your OWN BODY. What is your dream for your body, your health, your mind, how you feel? What do you believe is IMPOSSIBLE? GIVE IT UP. Give it up to earth, the sun, the wind, the soil, or throw it in the ocean or a volcano. Then get busy. Write down a plan. Are you going to just WALK for 10 minutes a day? That’s a start. SET A TIME and start today, not tomorrow. Cut down 2 cigarettes? Drink 2 more glasses of water? Stop eating sugar? Start keeping a journal of how you’re going to love your body and you’re on your way.

Yoga.

Monday. Yellow 9 Solar Seed


My Rose of Sharon bush

We are currently under the Guide power influence which is Yellow 9 Solar Sun and the sun is shining brightly where I am. It feels like it will be a good day to target our awareness of things that were hidden on our society.

Enlightenment is good. Either way, good or bad it’s essential to know the power of the human soul for good and evil. Why is there surprise for evil and an assumption of good? That is dangerous denial propogated by Disneyland mainstream media to keep us asleep. The analog is Blue 9 Solar Eagle. Like Icarus, he is flying so close to the sun (guide power) his wings melt.

We need a balance of light and dark. The antipode today is White 9 Solar Wizard who is RECEPTIVE. Its the feminine, the dark of the womb. The Wizard has dark vision meaning, like a cat, he’s nocturnal. Big synchchronicity there.

Lately the evil of Adrenochrome production is being talked about. Now most of us know what it is. There’s been a tremendous amount of vampirism on our planet between humans, I guess because we’re early on in our evolution we’re not very spiritually mature. The abuse of small children for their prana is the height of blood cult vampirism.

We have everything we need on this planet; the DNA in the seed, the radiation in the energies from the Sun have long been known by our ancient ancestors to provide our minds and brains through our eyes with everything we need. There is special energy in the Sun and in the Earth itself to provide for us. There is no need for us to hurt other people especially children, to have life force energy; prana or Qi.

But as we find ourselves, some humans, a very small number, have found themselves so enamored with the Earth plane that they’ve given their souls to money, sex, things. They don’t believe in God or anything outside of temporal time.

That’s all Luciferianism, evil seeds indeed, false gods that cause people to forget powers that are intrinsic in their mind, body and soul and then they do things that suck the energy off of other people.

As much as we want to judge what’s going on with this abuse in order to harvest adrenochrome the fact is is that a large majority of the planet believes that they have to follow each other or their families and suck energy off of each other in order to survive and thrive when the truth is you have your own soul power.

When we see our own body and our own blood, when you focus our mind and breath, we start to feel the life force in us or what some would call God. You don’t have to call it God. The spiritual movement says Source.

This is something that’s going to need to be discussed in the human community. Jow do we access Source? How do we stop this vampirism in society where we feel that we need each other’s energy in agreement all the time. The politics has practically destroyed us because of that demand for agreement! Stop it!

We can sit in our own sovereign soul space and share instead of sucking energy off of one another and getting so desperate that we have to be violent. This is the end of the road. It’s time to receive Enlightenment from the Sun from Source and have radiant synchronicity guiding us every day because we choose it ourselves.

Peace.

Activate Reflection To Bring Order to Bonding


Theme: White 3 Mirror, Analog; Red 3 Dragon, Guide Power; White 3 Wind, Antipode; Yellow 3 Star, Hidden Wisdom; Blue 11 Night

The Tone is 3 Electric; Bonding, Service, and Activate. Tone 3 kin are the current that electrifies situations.

The attributes today are; reflection, order, and endlessness, pure, face the shadow, discriminate and use the sword of wisdom is discern.

The analog is Red 3 Dragon; Nurture, being, birth, and blood memory, primordial mother

The Guide Power is White 3 Wind; Charismatic speech, communication and spirit.

The Antipode is Yellow 3 Star; Beautification, Art, and Elegance. Beautiful things are good and so is abundance. But when an individual is mired in resentment, jealousy, dependency and blame of family they hate people who are beautiful or have beautiful things. Jealously is a green eyed monster and it’s a challenge. I’ve learned to ignore jealous people; bless and release.

The Hidden Wisdom is Blue 11 Spectral Night. This is a Halloween placement. LOL. Dreams, Intuition, and abundance placed in spectral can be chaotic, strange and disruptive. That hits tonight at dusk and goes to midnight. I don’t know. It’s 2020 so it could be anything.

The 5GForce is White 11 Wind. It’s interesting that it’s the same as the Guide Power. I never see that with the 5GForce. Meaning? We are super activated to reflect but it will start out negative. Indeed, we have a Mercury Retrograde starting today and going through until Election day; November 3rd. It’s going to vitriolic because the cabal and and it’s minions are going down for the benefit of the planet. This is way beyond political party.

Amino Acids are Tyrosine, Cysteine, Glycine, Leucine, and Alanine. The Theme and the HW create the polarity in the Tzolkin. The double helix bonding point is Tyrosine-Alanine and adds up to 14.∞

It’s time to reflect on how Social Media, Facebook and Twitter have controlled and directed our relationships (bonding) and to be done with them. It was superficial. I don’t think anyone is conscious of it. I have been for months now. Think of kids that tend to fight or disagree in a family. Too many times the parents will step in and set boundaries and control the situation instead of letting the children work it out themselves. These are dysfunctional, fake households where the parents are uncomfortable with authentic emotional EXPRESSION, positive and negative, and freedom to say, “I don’t like you” as opposed to the common Twitter expression, “I hate you”. There is a lot of venomous criticism and gossip as well as pointing fingers on Twitter. It gets very tiresome, as though the Tweeter is perfect themselves? Good Grief. It’s particularly sad and desperate right now regarding Biden. Democrats need to reflect on why your party gave you a failing candidate like this? What is really going on? It’s unprecedented.

What’s really going on is there are ten layers of authority above Trump, which you would know if you didn’t just accept the media narrative, and he’s been picked to get a specific job done. We don’t live in democracy. It’s too early for that. He hasn’t been picked to be everyone’s favorite president and he’s not. He is a leader though, venom practically rolls off his back, he understands the extreme double standard from the public and that he’s been scapegoated. But he has a passion for this country and it’s potential. He’s no more sexist than Biden is. Admit it. Men are men despite their politics. He is not my favorite person but I know he can get Full Disclosure done if he chooses to. He’s being advised not to do it by people above him and has to manage the situation.

Facebook was the opposite. Everybody has to smile and be nice whether they feel like it or not, be sure and follow your neighbor and do what the Dr. says to do, don’t question authorities. I mean, TRULY NAUSEATING and very representative of abusive homes where predators and sex offenders go to church and rule the home with an iron fist. That’s Facebook; totally hypocritical. I will be so happy to be done on there today. The Facebook vibe is what the Administration is cleaning up worldwide and Facebook needs to be shut down for all their crimes against humanity. That’s how virulent sexual abuse and human trafficking makes it around the globe. CONTROL via sex from parents to children and probably parent to parent.

It’s all about who is going to control your TIME and your BODY, thus your Life Force, thus your LIFE. My work is about empowerment and order for humanity. I’m not taking sides in a dysfunctional two party system. I’m being of service to help people get in touch with their bodies are realize their power to take care of themselves.

The mediating planet is Neptune

Neptune.

Why Does the Galaxy Matter to Us on Earth?


“The galaxy and galactic things figure prominently in the Mayan Tzolkonics. The Milky Way galaxy is the context within which all Life and thus all DNA lives in it’s myriad forms but that’s just the beginning”

White 8 Galactic Mirror is Tyrosine and has a 5GForce of White 6 Wind or pulsing spiritual communication.

The Universal context within which all Life exists is immense and beyond our human imagination but I won’t let that stop me. Today we are on White 8 Galactic Mirror so it is now time to take a look at much of what is beyond human knowledge that is not shared by our larger culture. The Urantia Book is one such thing and I’ll do my best to nutshell this particular piece.

Part I is The Central and Superuniverses. Part II is The Local Universe. Part III is The History of Urantia (Earth). Part IV is The Life and Teachings of Jesus in detail.

Our Milky Way Galaxy is the central nucleus of our Superuniverse Orvonton. It’s the seventh superuniverse. Orvonton is south of the Milky Way Galaxy and Earth and it are in the southeast sector of Orvonton on the outside edge. We’re edgy, maybe even leading edge. Our local neighborhood universe on the southeast edge or Orvonton is Nebadon. The local system in Nebadon in which we reside is Satania, I suppose named for the once highly regarded and ever trusted angel of light, Satan. Please note that now he is regarded as the epitome of dark. Even in the Universe, people aren’t too big to fail.

That all changed and there are multiple stories of the Great War in Heaven in every culture. There is one in the Urantia Book and it’s pretty awful. I’m not going into that now. We’re sort of going through it ON EARTH right now and are at the tail end of what the benevolent ancestors watching over us are going to allow. Humanity is held like a babe in it’s mother’s arms. We are very guarded and cared for despite how other humans feel about each other. The Universe does not regard us lowly. We are held in high regard and our evolution means EVERYTHING to our watchers.

The Master Universe encompasses all of material creation. It includes the central universe of Havona (Heaven), the seven superuniverses and the four uninhabited outer space levels which revolve alternately clockwise and counterclockwise around Havona. In outer space millions of new galaxies are in the process of formation. The first outer space level is about 500,000 light years beyond the periphery of the Grand Universe.

That’s just a nutshell of the context of our galaxy. In the order of things, The Tzolkin, The Network Grid, galactic energy is about modeling integrity and harmonizing. White Mirror reflects Order and Endlessness which is why I brought the Urantia Book into the mix today. I’ve read the whole thing over a thirty year period and pick it up often and read it again.

If you’re interested in the details of the Lucifer rebellion it’s on pages 601-620. If you don’t have the book it’s also online. Lucifer and Satan are apostate princes and I do believe their mischief is at it’s end now, as of a couple days ago. It says they fought against the Dragon which is likely synonymous with the Red Dragon Tribe, The Dragon Family of China and The Draco E.T. who were just recently routed from the planet by the Pleiadians. The Tzolkin teaches all of that history and the DNA is all in there. Earth is a hodge-podge, a pluralistic fertile pool if you will and now we’re trying to harmonize all of it.

https://urantia.org

Our Superuniverse filled with myriad of inhabited worlds

Searching for A Universal New Year: The relevance of August 13th. By Rohaan Solare (my friend)


Presently there is no universal basis for what qualifies the start of a new year. Every culture has its own set of parameters for determining it. The Chinese celebrate theirs in either late January or early February according their lunar calendar. The ancient Egyptians linked the appearance of the star Sirius and the annual flooding of the Nile river to signal the start of their new year. (Lions Gate 8/8/20) The many cultures of India celebrate the new year on various dates during the month of April. Europe’s Nordic cultures keyed it to the Winter solstice. The Celtic, Samhain, now vulgarized as Halloween, is celebrated by present day neo pagans, Wiccans and Druids as the start of their new year.

The Maori of New Zealand looked for the appearance of the Pleiades in May to signal the start of the new year. The Hawaiians also pegged their new year to the appearance of the Pleiades, but their new year fell in October.

The Aztec-Mexicans celebrated the new year in early March several days before the spring equinox. Even the Maya celebrate 2 different new years dates. One equates to February 22 and some celebrate July 26th. (Dreamspell Version)

And then there is Gregorian January 1st to mark the start of the new year for Westerners. January 1st was arrived at as the start of the new year in order to honor Julius Ceasar’s exploit as the founder of the “rational calendar”.

Contrast that line of reasoning with the fact that the new year of non-western cultures is related to some seasonal and/or astronomical aspect. The foregoing is why I refer to the Gregorian calendar as an urban calendar, for it reflects the whims of the city lords more than anything else.

The most common denominator for the start of the new year in most other calendar systems is the start of the growing season or end of the harvest season. In some cases, either of the solstices or equinoxes are recognized as the start of the year. The start of the new year for cultures other than the Euro-western is related to the agricultural, seasonal, and astronomical particulars of each region.

A Bi-Universal New Year?: Solsticial New Year

Many pre-Christian cultures of Europe’s northern hemispheric latitudes recognized the winter solstice as the start of the new year as the Sun symbolically dies and is reborn on that day.

The start of the new year cycle can be viewed as universal for those in northern hemisphere when reckoned from the winter solstice, and as defined by the life cycle changes that accompanies the attendant atmospheric conditions (rain, dryness, snow, etc) as the sun ascends and descends. The same would apply to those of the southern hemisphere, except that their new year would start with what we in the north refer to as the summer or June solstice. I prefer to designate the solstices according to the month they take place within rather than say summer or winter, because the seasons are reversed depending on which hemisphere you happen to live in.

The process of cooling and warming is minimized in most parts of the tropical regions. The most defining aspect of seasonal variation in the tropics is dry and rainy seasons. Nonetheless it is the Sun’s to and fro movement, and its attendant affect on atmospheric conditions that drives precipitation patterns. Therefore we can associate the start of the new year with the solstice that marks the start of a rising Sun for each hemisphere, since it is the rising solstice Sun that initiates the life cycle for each hemisphere.

The solstices do indeed provide us with fixed starting points for each hemisphere’s respective new year as it relates to the life cycle, but might there be a truly universal new year that applies to the entire planet as a whole regardless of local particulars?

The Arguellen Universal Calendar Proposal

Jose Arguelles proposed the universal adoption of what he calls the 13 Moon Calendar. Thirteen “moons”, or months of 28 days, plus one day would give a clean, orderly and easy to use civil calendar. (13×28 = 364 +1 = 365) I won’t go into all the reasons on why a uniform calendar is far better than the Gregorian hodge-podge we have now. But if you think about it some of the reasons should become clear. He was not the first to propose a new and improved universal calendar.

His calendar proposal is based on the Mayan Tun Uc calendar which also measures 13 months of 28 days plus one day. Arguelles anchored the start of his 13 Moon calendar to July 26th. But why July 26th? What is so special about that date? The followingquote from his website gives us his rationale. 

“For many ancient peoples, including the Dogon and Egyptians of Africa and the Maya of Central America, the great star Sirius, the brightest star in the sky, was the galactic marker. The heliacal rising of Sirius – July 26 – commenced the Egyptian year”. ~ Jose Arguelles

The problem with his rational is that its mostly inaccurate. Sirius did loom large in Dogon and Egyptian cosmology, but I have yet to come across any information indicating that it had any sort of calendrical function among the Maya.

Additionally, the Dogon did not use the star Sirius as a calendrical marker. And the start of the Egyptian new year is July 19th not the 26th and the helical rise of Sirius is also around the same time–July 19-20.

Lastly, we did not understand the concept of a galaxy until the 1920’s when we discovered, thanks to telescopes, that we inhabit one of billions of galaxies. The Arguellen account does not give us any reason whatsoever to say that July 26th is the start of some universally valid new year, even though he insists it is.

There are two testable and key parts to his universal year cycle proposal. One is that it starts on July 26th and the other is that each of its 13 months are characterized by a set of qualities in the same way that each day of the Tzolkin’s 13 day tone cycle has it particular qualities.

In other words the 13 day tone cycle is a fractal of the 13 month year cycle, as proposed by Arguelles. The first month of the 13 month year cycle carries the same qualities as the first tone of the 13 day tone cycle and so on. But this article will focus solely on the question of universal new year and its probable start date, if one exists.

So what else can be said about July 26th?

The 365 day civil calendar of ancient Mesoamerica was known as the Haab among the Maya and as the Xiuhpohualli among the Aztecs. The ancient Mesoamericans did not anchor their civil calendar to any part of the year in the way the Gregorian calendar does by adding a leap day every 4 years. This means that the start of Mesoamerica’s civil calendar year drifted by one day every 4 years.

At the time of the Spanish invasion, the first day of Mayan Haab calendar, “0 Pop”, coincided with July 26th, and hence forth the Mayan Haab was fixed to July 26th for unclear reasons. Spanish imposition is most likely the reason for the Haab’s fixation to July 26th.

July 26th is also significant for one other reason, for it is the day that the Sun is at the zenith over two of Mesoamerica’s most important pyramid sites. Teotihuacan marked the solar zenith passage date for the Toltecs and Edzna marked the July 26th solar zenith passage for the Yucatec Maya.

But there is still nothing universal about a Spanish imposition, nor are solar zenith passage dates, for they will vary according to latitude within the tropics of Cancer and Capricorn.[fig. 1]

Finding the Center of Space and Time

The Tropic of Cancer is Arguelles N. Polar Zone in assessing the DNA in synchronicity with the earth, and The Tropic of Capricorn is the S. Polar Zone for the same reason. In between them is the Zone of Transformation. This is the alignment in EVERY CELL OF DNA ON THE PLANET and accounts for the double helix and radial polarity. -My comments, Lisa K. Townsend

August 13th is most famous for being the alternative start date for the beginning of the Maya Long Count Cycle. There is a 2 day discrepancy between when the Long Count may have actually started. The account with the most backing says its August 11th, 3114 BCE, and that date gives us the end date of December 21st, 2012. August 13th gives us the end date of December 23rd.

The Zapotec-Shearer-Arguellen Tzolkin may be able to shed some light on that subject, but that investigation will be for another time. And after this analysis I am inclined to think that August 13th may carry more weight than August 11th. The other principle reason that August 13th is well known among Maya scholars is due to the unique timing phenomena that occurs on August 13th, at the latitude of 14.8 north. I will have to forego the extremely fascinating history behind the discovery of August 13th at the latitude of 14.8 N for this article, but I will relate what is most salient to my purpose here.

The latitude of 14.8 north has the distinction of being the place where the sun’s two zenith passage dates combine to equate interval periods of 260 days and 105 days (105 + 260 = 365). Two hundred and sixty days is the number of days in the Tzolkin cycle calendar, or the most revered body of knowledge in all of ancient Mesoamerica.

Zenith passage dates can only occur between the tropics of Cancer and Capricorn.[fig.1] As the Earth tilts on its axis, we see the Sun rise and fall in the sky over the course of the year. The tropics, or the lines of latitude just mentioned, mark the Sun’s northernmost and southernmost points of inclination and declination. The tropic of Cancer is located 23.5 degrees north of the equator, and it marks the day the Sun is directly overhead on the June solstice. The tropic of Capricorn is located 23.5 degrees south of the equator, and it marks the day the Sun is directly overhead on the December solstice.

It has been suggested by many scholars that the 260 day Tzolkin and the 365 day civil calendar were developed at the ancient ceremonial site of Izapa. Izapa is one of two major ancient Mesoamerican ceremonial centers that are located at the latitude of 14.8. The other site is Copan which is found on the border between Honduras and Guatemala. [fig.2] Izapa is located near the Mexican-Guatemalan border.

John Major Jenkins and a few others believe that the Long Count Cycle was calibrated at Izapa, and they are probably right about that, but from my vantage point I believe that neither the Tzolkin cycle nor the 365 day calendar were discovered or formulated there.

I won’t get into my version now, but I will say that I believe that the Ancient Mesoamericans (AMA) sought out the place where the two primary measures of time, the Tzolkin and solar cycles met in perfect harmony.

Such a place would be nothing less than the place where the “Heart of Earth” meets the “Heart of Heaven” within their worldview. The Heart of Earth being the 365 pulses (beats) that we experience as a day-night cycle, and the Heart of Heaven being the 260 pulses of the Tzolkin cycle. In other words, the Tzolkin was regarded as the primary or cosmic timing standard. The implication is that the solar cycle is a local timing standard, particular only to our unique place in time and space, but nonetheless supremely relevant to why our solar system harbors life.

Orienteering 101

In order to show what is meant by the foregoing, let’s begin with the Sun at the December solstice. On the Sun’s northward journey it crosses the zenith over Izapa on April 30th.

The Sun continues climbing until it stops its northward journey on the June solstice, or the day the sun is directly over the tropic of Cancer, and once again begins its southward journey toward the winter solstice. On its southward journey it will again be directly over Izapa on August 13th for its second zenith passage.

Please note that our warming season from winter to summer solstice corresponds to when the earth’s northern hemisphere is tilted toward the sun and the opposite is true in the winter time.

April 30th to August 12th equals 105 days and from August 13th to April 29th there are 260 days. (260+105=365) The two solar zenith passages are separated by 105 days in the former interval, and by 260 days in the latter.

The interval from August 13th to April 29th places the December solstice smack dab in the middle at 130 days or one half of a Tzolkin Cycle.

Furthermore, there are 52 days from the summer solstice to August 12th, and we well know that the number 52 was highly revered by the AMA for its meaning within their understanding of time.

August 13th would be the equivalent of our January 1st and August 12 would be the same as December 31st.

But why August instead of April?

August 13th came to be known among the AMA as “the day the world was born” and “as the place where time began“. But why did they pick the August zenith passage date over the April zenith passage to anchor the “day the world was born”, and mark the start of the new year and the Long Count cycle?

The one thing that comes to mind is that they recognized the December solstice as the start of the solstice to solstice year cycle, and so that would make the August zenith passage the second or completing zenith passage date, hence completing the centering aspect of the Sun’s passage and the next passage date is a full 260 days away with the winter solstice perfectly balanced between the 2 zenith passage dates.

We must remember that one of the AMA’s most important cosmological quests was worldcentering, therefore they would value counting the year cycle from center point to center point, rather than from extreme point (summer solstice) to extreme point (winter solstice) so to speak. Following this line of reasoning, I looked to the night sky to see if it could shed some light on this subject.

I set my astronomy software to 3114 BCE to see if the night or day sky at the zenith time over Izapa might reveal something telling about why else the August 13th zenith date might have been favored over April 30th. I discovered that the Milky Way straddles the north-south meridian at midnight in such a way as to form a perfect cross just 20 degrees from the zenith. The four quarters of the world are made manifest by such an event, and the observer is at the very center of it all. On April 30, the Milky Way is not perpendicular to the zenith meridian until the dawn.

The actuality of the evening’s most revered object, the Milky Way, forming a cross with the north-south meridian at the zenith and at midnight, on the same day that the day-time’s most revered object, the Sun, is at the zenith only reinforces the idea of August 13th as the center of space and time in the most literal of terms.

There is one other consideration, and that is the agricultural season. The first corn crop is sown to coincide with the start of the rainy season around the end of April-start of May – the time of the first zenith passage. The first harvest happens right around the middle of August or near the second zenith passage. We know that harvest time is often a factor for pin pointing a year cycle start date among other cultures, but this aspect, unlike the first two, is not a universal condition, and we are looking for universal parameters.

August 13th: Ancient Mesoamerica’s Universal New Year

It seems that August 13th was regarded as the start of a universal new year among all major pyramid building cultures of Mesoamerica. It has been found that at least one major aspect of almost every major ceremonial center has an axis or focal point of some sort aligned with the sunset of August 13th. In other words it was widely acknowledged that Izapa was situated at the “Heart of Earth” and that the work done at Izapa was supremely important to the foundation of Mesoamerican cosmology.

In acknowledgement of Izapa and August 13t, other ceremonial centers oriented at least one major structure toward the sunset of August 13th. In other words Izapa represented nothing less than the place where the tangible fulcrum of earthly time, and the intangible fulcrum of cosmic time met in perfect harmony.

Three hundred and sixty-five days is the measure of earthly time and 260 days is the measure of cosmic time. Heart of Earth and Heart of Sky are two very important metaphors in Mesoamerican cosmology, for they too, like so many other cultures, recognized that everything emerges from some infinitesimal center place.

The perceptible Heart of Sky is the zenith, and also from Izapa they discovered the intangible, but supreme center of our local universe, or the heart of our Galaxy.

So it was that they developed the Long Count to calibrate when Father Sun would be reborn from the Cosmic Mother. (Jenkins Maya Cosmogenesis). By doing so they achieved the holy grail of Mesoamerica’s other great quest known as Worldrenewing.

For more on the concepts of Heart of Earth-Heart of Heaven and Cosmic and Earthly time, please see Cosmic Time Meets Earth Time: The Numbers of Supreme Wholeness & Reconciliation Revealed

Before concluding I want to go back to July 26th. As mentioned earlier the zenith of July 26th was marked by the ceremonial centers of Edzna in the Yucatec Maya lands, and at Teotihhuacan – land of the multi-culturally composed Toltecs.

Edzna was the first major ceremonial center of the Yucatec Maya and Teotihuacan was the major ceremonial center for the highland Toltecs. The pre-imminent Maya scholar Vincent Malmstrom thinks that the northern periphery of grand Mesoamerican culture, as marked by Edzna and Teotihuacan, switched the official start of the new year from August 13th to July 26th.

According to Malmstrom, a calendar reform of sorts took place in the year 48 CE, in which July 26th became the new “new year” start date for the Yucatec region and Teotihuacan, since both centers were built where the sun is at the zenith on July 26th.

We don’t know exactly what prompted this change, but Malmstrom thinks it had to do with having a “locally relevant new year”. It may have been a political tactic to establish Edzna as the new power center of an emerging civilization.

Even so they continued to acknowledge the universality of August 13th as they made sure that one axis of a major pyramid was oriented toward the setting sun of August 13th. August 13th became a foundational orientation to many if not all major ceremonial centers.

Earlier I mentioned that the Maya civil calendar, the Haab had been fixed to start on July 26th at the time of the Spanish invasion. Thus the prominence of July 26th in the historical record was doubly reinforced, since the roving start date of the civil calendar, and the July 26th solar-zenithal passage new year are two distinct ways of measuring the year cycle.

Recently I met a Maya man from Guatemala, and he did confirm that July 26th is still recognized as the first day of the new year, and this had nothing to do with the Arguellen proposition to create a new universal calendar with July 26th as its start date. Arguelles it seems borrowed the start date for his universal calendar proposal without giving full disclosure as to why he had chosen that date.

Conclusion

August 13th has a couple of strong reasons as to why it’s a prime candidate for a universally valid start of the year. July 26th is another serious choice because of its strong presence in the historical record. However, there are problems with the July 26th date because we have yet to discover any universally valid properties to that day.

Whatever the case, the month of August looms large in the historical record as it relates to the story of 2012 and Mesoamerican history. The following list of events only seems to affirm the significance of the time period called August:

  • Either August 11th or 13th is the start date of the Long Count Cycle.
  • Hernán Cortés began his march on the Aztec capital on August 16th, 1519.
  • The Aztec Empire fell on August 13th, 1921.
  • The atomic bombings of Hiroshima and Nagasaki happened on August 6th and 9th respectively.
  • Tony Shearer fulfilled the prophecy of the 13 Heavens and 9 Hells prophecy cycle by calculating its end date on August 16th-17th, 1987. The fact that Arguelles was able to successfully convoke a global gathering on those two dates (Harmonic Convergence) lends even more weight to mid-August as some sort of peak moment in the solar cycle.   Harmonic Convergence was a major event in the history of humankind, for it was the world’s first global ritual event and it took place before the internet was publicly available.

Those of you familiar with my article on Anticipating Personal and Collective Shifts in relation to MAC Time Science, should consider mid-August 13 as a cycle juncture window. A cycle juncture window is a period of time before and after a cycle ending zero date or August 12th in this case. Shift-type events are most likely to happen during a cycle juncture window; review the article in question for more details.

May you all have a joyful August 13th!

Continue reading “Searching for A Universal New Year: The relevance of August 13th. By Rohaan Solare (my friend)”

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that. I agree with social distancing but not the masks. Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

We Meditate in Order to Focus. Our Thoughts are Seeds.


The planet on the right is Jupiter. Meditation is channeling and focus is targeting. Those are Yellow 7 Seed Attributes. We meditate within our bodies and then our body/mind interacts with MIND all around us. We can choose what we let in and what we don’t. Activating the power of our minds is frankly the only way we’re going to get out of this mess of others controlling the human race. We’ve let this happen by default.

Yellow 7 Seed resonates AWARENESS of the context within which we live and have our BEing. A physical seed is a DNA seed packet that drops to the earth and sprouts. A woman’s egg is a DNA packet that drops in the uterus, is fertilized and creates a human. That is an exact analogy to our MIND seed packets that we drop in the ether and they literally sprout. I’m asking you to meditate on the LITERAL nature of THE MIND and TIME as DNA and the power of Life Force that it has.

Look at the phenomenal plant life on earth that came from a tiny physical seed! Now imagine that 100 times or more with the power of human intention backed up by the timeless universe with regard to our thoughts and feelings. You may assert your positive gratitude and happiness path a bit harder instead of indulging in anger and pettiness on social media next time. The whole planet needs to PIVOT on that. I deactivated my Twitter account. That thing is TOTALLY negative. So is T.V. Negative mindset is the most destructive thing on the planet and we should not be part of it. In essence, we’re destroying ourselves if we do but maybe that’s what some people want because they literally don’t believe that Love and Goodness exist in the Universe. They don’t believe there is a God. Ok, then!

This process is called ATTUNEMENT and is also an attribute of RESONANT TONE 7. I am a Reiki Master and teach Reiki classes and do attunements for my students. Their mind and body has become aware of their Qi or Ki and now they have learned how to FOCUS their QI to heal themselves and others. It’s not much different than tuning up a musical instrument or the singing voice. I am also a degreed musician. The musician and actually all artists are athletes in that our creative expression comes through our body. You have to be in shape and in tune with your biorhythm to do well in your craft. That’s also the case with bodyworkers.

Being a Reiki Practitioner is like being a gardener organizing and tending to their garden. Each client is a Seed that wants to get comfy in the soil of their body and SPROUT! ReiKI is like the SUN.

The 5GForce today is Yellow 7 Warrior, the GUIDE POWER. That’s odd. The Moon was in Sag and is now in Capricorn so there is some affinity today between Jupiter and Saturn on every level.

  • The Theme in the middle is Yellow 7 Seed, Valine
  • Analog is Blue 7 Eagle, Arginine
  • Guide Power is Yellow 7 Warrior, Histidine
  • Antipode of White 7 Wizard, Lysine
  • Hidden Wisdom is Red 7 Earth, Phenylalanine.

The pentagon in histidine is tetrahedral which is the Hydrogen molecule. It appears to me that Jupiter has had a major role in making sure hydrogen is distributed to planets that are going to evolve life. Saturn has the hexagon which is in Phenylalanine. JUPITER is the mediating planet today.

Red 1 Magnetic Serpent is about Survival, Passion, and Instinct. New 13-Day Cycle.


There’s the asteroid belt not far from Earth. It used to be the planet Maldek/Tiamat. Mars was it’s moon. Obviously, the asteroid belt is 3D. It’s really there held in orbit by?… It’s own dreamspell which each planet has. In other words, it’s own electromagnetic signature, like a person’s fingerprint. It lends credence to validity of ASTROLOGY. Geez, look at how big Jupiter and Saturn are. We JUST brought them into check finally. They had us under the false timing frequency of 12:60 and believing the #7 was spiritual. No it’s not. 13:20 is the TOP DEAL.

Red 1 Magnetic Serpent starts us off today and Red 13 Earth will end up the cycle. So we go from honing our survival instincts to having Cosmic Synchronicity with which to navigate our NEW EARTH in the Aquarian Age. Aquarius is ruled by Uranus whose Time Tunnels are now open in the Cosmic Web. Keep an eye on your Red Earth-White Wind Kin. They are now getting unconscious downloads.

Meditation, emotional authenticity, passion, and intimacy will be powerful attractors and catalyzers over the next 13 days. In addition, MERCURY GOES DIRECT today. The Sun may be in Cancer but with Mars in Aries and the recent Jupiter-Saturn conjunction, nothing feels terribly homey. Today there is a square between Mars and Sun in Cancer as well. With Yellow 13 Warrior as the Hidden Wisdom we’ve got the highest level of mental discipline and intelligence possible and could actually get some good work done. That’s what I’m doing.

We also enter the Blue Western Castle (52 days) of Burning today. It’s the Court of Magic and it’s mission is to transform the stars. We enter IChing Hx 59 which is Dispersion and Dissolution as a 3D influence! There are 5, 52 day castles in a 260-day cycle. 5×52=260.

The 5G Force from the 5th Dimension is Blue 13 Eagle which was the ANALOG YESTERDAY! That is a big synchronicity. Cosmic Vision and authenticity with that is vibrating at warp speed.

MOLECULAR LINE-UP

Arginine and Lysine are the synchronous molecules with plenty of carbon again. Histidine and Phenylalanine look alike also. Vision, receptiveness, Intelligence and Navigation are in our DNA!!!

Serine is Red Serpent,

Lysine is White Wizard,

Aspirigine is Blue Eagle and

Histidine is Yellow Warrior.