Dr. Chavez Had A Stroke

Dr. Fernando Castro Chavez

It happened two weeks ago and I didn’t say anything because it’s too f…..g depressing.

He’s alive and rehabbing in TX now. It occurred in his lower limbic brain so they think with time he may be ok.

Dr. Chavez was extremely outspoken and emotional about the virus and the vaccine as well as very knowledgeable because he was looking at it in the lab. I posted on it often and was analyzing the sequence according to the Tzolkin but didn’t finish so I could get my book done. I’m hoping they didn’t force the vaccine on him in the hospital which is even more depressing.

He had lost his job at the NY school because of his positions and feelings (politics) and I have to wonder if this was some kind of c!@dl attack on him because he worked with high-ranking people. His sister is in touch with me.

Dr. Chavez was the only microbiologist familiar with my work and the Tzolkin. He was also complementary and supportive. I was about to ask him (hire him) to edit my book and give comments before I print in paperback. Now what am I going to do? Par for my course in this life. I ALWAYS hit walls but I never give up.

Everything happens for a reason 😌 so what is the synchronicity? I don’t know yet. I may ask a couple biology profs at my alma mater to look at it and watch their eyes glaze over. Oracles? Amino Acids? E.T. ancestors? Oh god. Maybe not. As of November 2022 I have heard nothing back. I figured as much.

Please send good vibes for this info. If I’m on to something, and I’m sure I am, “they” may try to stop me. It’s too empowering and would change the sciences. What does a woman without a Ph.D. think she’s doing? They have no idea.

Maybe it’s about timing. We’ll see.

Peace. Red 13 Cosmic Skywalker, Lisa T.

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon

Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.

Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

%d bloggers like this: