Thursday; Evolution of 10 Cysteine (Red 10 Planetary Dragon)


Cysteine is the Theme; Red Dragon and Methionine is the Guide Power; Red Moon. The analog is 10 Tyrosine; White 10 Planetary Mirror. They are related to each other in 3D clenching Amino Acid sequences.

Their real power lies in multidimensional TIME controlled by our MINDS. Red Dragon tribe is blood memory and primordial mother. The alligator is progeny of Red Dragon and they are very good mothers, maybe the best. Remember mammals evolved from reptiles!

Cystathionine β-synthase (CBSis a unique heme- containing enzyme that catalyzes a pyridoxal 5′-phosphate (PLP)-dependent condensation of serine (Red Serpent, Red Dragon’s progeny) and homocysteine to give cystathionine. Synchronicity.

Cysteine, Tyrosine, Methionine, Asparagine, and 4 Stop Codon.

With the Start Codon and the Tone 4 Stop Codon in there, this is a themeplex taking a reading on our birth DNA via our Mother. Tone 4 is self-existing so it applies to each individual and the soul lessons they’ve learned from their mother.

We are in a new Harmonic 26; Cosmic Input; inform the flowering of Presence which speaks to Yellow 13 Cosmic Seed which will end this 4-day cycle. It’s ruled by Jupiter and there is much activity on Jupiter right now so I’m sure this has something to do with it. I posted 2 events on this blog about it.

The 5GForce today is Blue 4 Self-Existing Storm and so this is independent self-generation being tracked in each person. How are you doing with that?

This is a test day. You can tell where you are by what you’d say you’ve learned from your mother no matter what your relationship is to her. We’re not obligated to like our mother’s and many mother’s don’t get along very well with their grown children. But you can’t really do a cut off. The bond is too great and therefore, you do need to keep learning about who you are or want to be as a soul by looking in the mirror of your mother. The analog is White 10 Planetary mirror and there is no stronger planetary mirror than your mother. I think these are the cutest pictures ever.

Watson and Crick Were Silenced by the D.S. And Watson Had His Nobel Prize Taken Away for One Comment he Made. All that and Rosalind Franklin’s Photo 51 was Responsible for SHOWING the Double Helix. She was Ignored. The Three Men Won the Nobel Prize.


I wonder if they worked with Operation Paperclip? This link is really something and just brings up more questions for me. Be sure and look at this website and it’s videos and the video below.

https://dnalc.cshl.edu/view/15470-The-moral-responsibility-of-scientists-in-Nazi-Germany-James-Watson.html

I can hardly stand having this on my computer, it’s such bad energy. This is James Watson; founder of our CURRENT science on DNA? Holy Crap. I 100% disagree with him based on what we know now about the Tzolkin and Time and EPIGENETICS. OUR MINDS and OUR CHOICE control our DNA. We ARE equal in our ability to choose. IMO his statement is ignorant, but none of us are 100% correct. Still, something in humans tells us that because we are all Equally loved and cared for by the Universe, we can make a go of it with what we’ve been given and that has NOTHING to do with our Birth Genes.

Francis Crick and James Watson, Molecular Biologists

The Tzolkin Themeplex for the day of discovery of DNA by Watson and Crick; February 28, 1953

8Histidine is the Amino Acid of a Galactic conflict. Still, at least their work was guided by our Sun. But look at the antipode; 8Threonine is death and change. And there is 6Serine, the Reptilians underneath. It’s pretty straight forward. “You would be wise to keep some of what you see under your hat for now.” The Reptilians back in 1953

1-Crick
Francis Crick in his office in his later years. Author: Marc Lieberman
2-Crick
Francis Crick and James Watson

Crick asked himself how it was possible that nature had simultaneously invented two mutually interdependent elements of life: the genetic material –nucleic acids, such as DNA or RNA– and the mechanism necessary to perpetuate it –the proteins called enzymes–.

The synthesis of the nucleic acids depends on the proteins; the amino acids, but the synthesis of the proteins depends on the nucleic acids. Faced with this chicken-and-egg problem, Crick and his colleague Leslie Orgel reasoned that life should have arisen in a place where there exists a “mineral or compound capable of replacing the function of the enzymes, and from there it would have been disseminated to other planets like Earth by “the deliberate activity of an extraterrestrial society.”

The truth is that directed panspermia does not detract from Crick’s thinking at all. Quite the contrary, it reveals the powerful workings of a theoretical, incisive and restless mind, eager for rational answers, even unconventional ones. To understand how Crick came to the idea of panspermia, we must go back a few years. The son of shoemaker Weston Favell (Northampton, UK), Francis Harry Compton Crick (June 8, 1916 – July 28, 2004) reached the end of his childhood with the main aspects of his identity already defined: his penchant for science. As for the first, he chose physics.

Molecular biology might have lost one of its founding fathers had it not been for the war. Crick began his research at University College, London working on what he described as “the dullest problem imaginable” – measuring the viscosity of water at high pressure and temperature. With the outbreak of World War II, he was drafted into the army to work on the design of mines. After the end of the conflict, he discovered that his equipment had been destroyed by a bomb (in his autobiography he spoke of a “land mine”), which allowed him to leave this tedious research.

Crick then had to choose a new field of research, and that was when he discovered what he called the gossip test: “what you are really interested in is what you gossip about.” In his case it was “the borderline between the living and the nonliving, and the workings of the brain,” in a nutshell – biology, or, as a physicist – biophysics. He began working on the structure of proteins in the Cavendish Laboratory of Cambridge, until he met an American named James Watson, twelve years younger than him but already with a PhD that Crick had not yet obtained for himself. Watson & Crick, and their DNA model in the Cavendish Laboratory (1953). Author: Antony Barrington Brown

The two researchers discovered that they shared a hypothesis. At that time it was believed that the seat of inheritance lay in proteins. Crick and Watson thought that genes resided in that unknown substance of the chromosomes, deoxyribonucleic acid (DNA). And that conviction, along with the participation of Maurice Wilkins and Rosalind Franklin, would give birth on February 28, 1953 to one of the greatest discoveries of twentieth century science, the double helix of DNA. The work was published in Nature on April 25 of that year. Crick would not obtain his PhD until the following year.

But although Crick is known primarily for being one of the founders of this milestone of molecular biology, the truth is that he himself laid the first rails of this new science. It was he who proposed that DNA was transcribed to RNA and that this was translated by means of adapter molecules in charge of converting the genetic code for proteins, the building blocks of life. And it was this “central dogma” of biology, as he himself baptized it, which led him to publish in 1973 his hypothesis of panspermia, by then such an elegant idea that it even counted astrophysicist Carl Sagan among its proponents.

Only years later would it be discovered that RNA can act by itself as an enzyme without the intervention of proteins, thus solving the problem that inspired panspermia. In 1993, Crick and Orgel published an article that no longer made any mention of an “extraterrestrial society”.  (Who shook that out of them? Scientists have always been pressured to agree with the Government/Military/D.S. narrative)The chicken-and-egg problem “could be resolved if, early in the evolution of life, nucleic acids acted as catalysts,” they wrote.

By this time Crick had changed continents and fields of study; in 1976 he moved to the Salk Institute in La Jolla (California, USA) for a one year sabbatical that would end up lasting for almost three decades. It was there that he settled his unfinished business with the second of his gossips: the brain. For the rest of his career, and in collaboration with neuroscientist Christof Koch, at the California Institute of Technology (Caltech), he devoted himself to trying to locate consciousness in the brain matter. “You, your joys and your sorrows, your memories and your ambition, your sense of personal identity and free will, are in fact no more than the behavior of a vast assembly of nerve cells and their associated molecules,” he wrote in 1994.

He never managed to unravel the problem of consciousness, although he made significant advances in the knowledge of visual perception. In 2004, he lost his battle against colon cancer, but never lost the courage or the passion for the study of life. According to Christof Koch, “he was editing a manuscript on his death bed, a scientist until the bitter end.”

This is from History.com

They saw Rosalind Franklin’s photo 51 of the DNA that SHOWED the double helix just before their announced their discovery. Her student Wilkins showed it to them but she never learned that he did that. Wilkens then shared in the Nobel Price so it was just the three men and Rosalind was ignored.

On February 28, 1953, Cambridge University scientists James D. Watson and Francis H.C. Crick announced that they have determined the double-helix structure of DNA, the molecule containing human genes. The molecular biologists were aided significantly by the work of another DNA researcher, Rosalind Franklin, although she is not included in the announcement, nor did she share the subsequent Nobel Prize award for it.

Though DNA—short for deoxyribonucleic acid—was discovered in 1869, its crucial role in determining genetic inheritance wasn’t demonstrated until 1943. In the early 1950s, Watson and Crick were only two of many scientists working on figuring out the structure of DNA. California chemist Linus Pauling suggested an incorrect model at the beginning of 1953, prompting Watson and Crick to try and beat Pauling at his own game. 

LISTEN NOW: HISTORY This Week Podcast: The DNA Debate

On the morning of February 28, they determined that the structure of DNA was a double-helix polymer, or a spiral of two DNA strands, each containing a long chain of monomer nucleotides, wound around each other. According to their findings, DNA replicated itself by separating into individual strands, each of which became the template for a new double helix. In his best-selling book, The Double Helix (1968), Watson later claimed that Crick announced the discovery by walking into the nearby Eagle Pub and blurting out that “we had found the secret of life.” The truth wasn’t that far off, as Watson and Crick had solved a fundamental mystery of science–how it was possible for genetic instructions to be held inside organisms and passed from generation to generation.

Watson and Crick’s solution was formally announced on April 25, 1953, following its publication in that month’s issue of Nature magazine. The article revolutionized the study of biology and medicine. Among the developments that followed directly from it were pre-natal screening for disease genes; genetically engineered foods; the ability to identify human remains; the rational design of treatments for diseases such as AIDS; and the accurate testing of physical evidence in order to convict or exonerate criminals.

Crick and Watson later had a falling-out over Watson’s book, which Crick felt misrepresented their collaboration and betrayed their friendship. 

A larger controversy arose over the use Watson and Crick made of work done by another DNA researcher, Rosalind Franklin. Colleague Maurice Wilkins showed Watson and Crick Franklin’s X-ray photographic work to Watson just before he and Crick made their famous discovery. The imagery established that the DNA molecule existed in a helical conformation. When Crick and Watson won the Nobel Prize in 1962, they shared it with Wilkins. Franklin, who died in 1958 of ovarian cancer and was thus ineligible for the award, never learned of the role her photos played in the historic scientific breakthrough.

Citation Information

Article Title

Chemical structure of DNA discovered

Author

History.com Editors

Website Name

HISTORY

URL

https://www.history.com/this-day-in-history/watson-and-crick-discover-chemical-structure-of-dna

Access Date

March 22, 2021

Publisher

A&E Television Networks

Last Updated

March 2, 2021

Original Published Date

November 24, 2009TAGSSCIENCEBY HISTORY.COM EDITORS

© 2021 A&E Television Networks, LLC. All Rights Reserved.

The Gene Expression of Resonant Threonine. Full Moon is in Leo Ruled by The Sun


I channel in order to Equalize.

Inspiring Opportunity I seal the store of Death with the Resonant tone of Attunement.

I am guided by the power of Endlessness

The Tzolkin #46

Today is White 7 Resonant World Bridger; THREONINE; mediating planet is Mars, so we’re in an echo chamber where what we see and hear bounces back to us quickly. It’s not synchronicity but more like immediate karma. Time is different under a Tone 7. It spirals more quickly.

The attributes are Equalize, Opportunity, Death and Change. Forgiveness, surrender, transformer, conscious, humble, transmutation, grounded in Spirit

The analog is Red 7 Resonant Skywalker; GLUTAMINE who doesn’t do too much of the above, but because World-Bridger is my analog I’ve learned to do it. Skywalker explores space, is AWAKE, accomplished but gets little credit for it, pillar of heaven and earth, knowledgeable, dimension traveler, crusader, assumes challenges and is socially principled.

The Guide Power this morning is White 7 Resonant Mirror; TYROSINE Wow…that will make your head spin like being in a carnival House of Mirrors on weed or some other drug. The short of it is, this NEW ENERGY is settling in now and the big, positive shifts are about to occur. My brain and head have changed. My pineal gland had to be dialed down and was giving me headaches because the energy was too intense. Make sure, if you a lightworker, that you keep your grounding in the body normally, and ask for help with that from Spirit. They are disembodied and don’t know how slow and hard it is to keep a homeostasis in physical while being very aware of other dimensions. You have to ask. Today’s line-up is a good time to do it.

The antipode this afternoon is Yellow 7 Resonant Warrior; HISTIDINE questioning, fearlessness and intelligence. These kin are pragmatic. Better make a plan before Mercury goes retrograde tomorrow.

The Hidden Wisdom at dusk is Blue 7 Resonant Eagle; ARGININE; Create, Mind, and Vision.

The 5GFORCE is White 7 Resonant Wizard; LYSINE

If I Miss A Day…


It’s necause I’m finally making big headway on my book; ‘DNA is TIME 13:20. I figured out how to get my large, complex document that illuminates the binary triplet configuration according to the Square of 8 into the book. I put each Tzolkin themeplex into each square of the 64 harmonics and found amazing patterns.

I’m still studying it and now the biologists will be able to also. I used the single letters for each of the amino acids with the tone in front of it and added a few more key components for analysis on the table.

It will take up eight pages of my book and I’m thrilled I figured out how to fit it in. Explaining it will be another challenge.

I took all of it off of my laptop to be safe. My instinct is it may not be safe to publish until the Deep State is off the planet and our local system is cleaned up of n’er do wells. It may be a few years. U.S. Space Force has it’s work cut out for them.

This information will help all species; human and stellar understand how we are one family OF TIME in the Universe. We are all held by the Creator, not withstanding certain universe mistakes that need a hearing.

Peace comes by unity in diversity. It’s not just earth that needs healing. We have to understand that even though we look very different we share the same DNA.

Image from Earth Ascending by Jose Arguelles

Monday. Blue 5 Overtone Storm


Commanding Radiance and Empowerment

Today is Blue 5 Overtone Storm so there is some EXTRA push energy to put a fire under your butt and get moving. I feel it very strongly and my body is changing quickly. Earth is an active planet. The DNA is always moving and changing due to the various RNA that is mutating in sequence with the Tzolkin. There is just no running from that. Masks, vaccines, isolating all PROCRASTINATE on getting the virus, letting it change your DNA and then creating antibodies.

Everyone has to do that and millions of people say, “No I don’t! I’m never getting it” They’re saying it because they believe they are too weak and it will kill them. Then you better get busy shoring up your immune system naturally or have your will ready! The vaccine is not going to cover all the bases! It’s not a panacea as people fantasize. These are the times we’re in. This is not a rough virus unless you are lazy, indolent and fearful. You either evolve forward and change or you will atrophy and drop away. No sentient life on this planet has a choice about that.

That calls for ACTIVE WORK, empowerment from within, taking action, a desire to be radiant so that you can SHARE it, not so your ego gets bigger and you can gloat on it. You don’t need others to approve of that. Beauty and radiance are the status quo on this planet. It’s a KNOCKOUT! Enjoy your time while you’re here and ignore the rest.

Amino Acids mutating are Tryptophan, Stop Codon, Isoleucine, Methionine, and Glycine. Please note that we have STOP CODON and START CODON in the same themeplex that is a G.A.P. kin. That means we begin a NEW sequence today as an entire species. The start codon in the antipode position means there is some RESISTANCE to communicating (White Wind) more authentically. Humans need to stop lying to themselves and others and believing lies because it’s comfy.

PLUTO is the mediating planet today so we’re further out in the solar system. Neptune/Pisces is still spinning from yesterday also. The Moon is in Pisces today which is our antipode.

The analog support is Yellow 5 Sun; Radiant enlightenment.

The Guide Power is Blue 5 Hand; Empowering Accomplishment.

The Antipode Challenge is Red 5 Purifying Moon which is mediated by Mercury. That is part of the Neptune alignment today with Moon in Pisces. This speaks to over sensitive feelings that could sink you into self-pity. Don’t need to go there.

The Hidden Wisdom is White 9 Solar Wind so getting your body and eyes outside, in the fresh air and in some sunlight may bring a breath of spirit to your awareness.

The 5 GForce is Red 9 Solar Dragon; Blood Memory, Nurturing and primal mother energy. Today is a Galactic Activation Portal so there is definitely energy here to change things up to what your would like them to be and to make a plan to do what you can, that IS within your control to do it. You cannot control others. Important to remember that today.

Sunday; Blue 10 Planetary Monkey; Analog Yellow 10 Star. We can change our own DNA by Receiving Downloads Via The Sun.


RED 4 SELF-EXISTING MOON is our 5GForce. It is METHIONINE or the START CODON.

We’re already into the antipode for the day which is Red 10 Planetary Dragon. The Guide Power from dawn to noon was Blue 10 Planetary Storm and it has been super stormy in Michigan.

With Red Dragon we move into some memories of our mothers, our ancestors, our feelings about that, nurturing and Being. Don’t hesitate to make this upcoming Thanksgiving and Solstice extra special since this is a CAPSTONE, a PINNACLE, the top of the mountain as far as our evolution and balancing for the planet. It’s not comfy and easy but it is getting better. We are getting more and more disclosure and RECKONING between right and wrong, dark and light spirituality.

We also have the opportunity and ability to do DIRECT DOWNLOADS from the sun for new RNA sequences to balance our own damaged DNA issues so that we can slowly come into our LIGHT BODIES as the EARTH comes into HER LIGHT BODY.

It just happened to me with my left leg. I had been working on it myself for months doing deep manual therapy and Reiki, I lay on my bed in the direct, hot sun last Wednesday and automatically received a crazy download like a computer software program of numbers and symbols really fast INTO MY CLOSED EYES. I just relaxed knowing that I was being helped or given information from our ancestors. I know how to receive information I don’t understand and not try to analyze it. Then I went about my day.

That night I felt lightly virusy and got the chills and ran a fever of 100 degrees +, no biggie, but I felt sick. Then my left leg that had been crushed (the soft tissue) 47 years ago, where I had been working on dense scar tissue, got very red and felt very strange. I couldn’t walk on it for three days. I knew from looking at it that the BLOOD finally released like a damn into my old injured ankle and foot. When blood circulation is blocked in injured tissue the tissue cannot heal. That tissue has to be released but of course sick care industry has no clue and never pays attention to the flesh medically. I very gently worked on it and it was getting better quickly. How was this old injury related to what I interpreted as a virus?

It was not “an illness” which is what we think of as “a virus” I was told. The only way these RNA packets can explode in our earth bodies is if they turn on or challenge the IMMUNE SYSTEM with a certain amount of stress. Just bc your immune system is challenged doesn’t mean you are literally sick. True sickness is when you sit in a very negative mind and heart set over time and cause DIS EASE or UN EASE in your soul. Then you get very sick. I had asked and wished, multiple times for that lower leg to be the way it used to be so I would no longer have neuropathy in that foot! It would keep me up at night.

It’s gone now folks. My foot is normal. The ankle is almost normal. The leg is already. The download was a mental RNA packet coming into this dimension as a challenge to my immune system to uptake the new sequence. We have to allow this or we won’t evolve upward. Some entities on this planet would prefer that. I don’t prefer it. That then mutates my own DNA and makes it what it was before in that leg. EVERY MOLECULE OF OUR BODY HAS DNA. Every molecule of our body exists and has existed IN TIME. OUR SUN REGULATES ALL OF IT AND HAS THE CODES THAT EACH OF US NEEDS. There are two suns; the sun we see and the sun that is hidden which is directly tied to Galactic Center. There is no limit in time or space (physical holographic projection in our world) of what is possible. It’s up to OUR MINDS TO FOCUS and CHOOSE what we want. Now it’s time to do it. We can do it and I’m giving you the HEADS UP!

I desperately want my BODY in THIS TIME AND DIMENSION to be WHOLE AND AGELESS. I’m going to have it because I have plenty to do on this planet before I take off. Dare you to try it.

Monday; The Evolution of Amino Acid Asparagine


Robert Downey Jr. and Caley Cuoco both have this as their Birth Destiny Gateway. I like the both as actors very much.

In the ancient Mayan tradition this is Blue 3 Monkey. It’s attributes are; play, illusion in the matrix and in the hologram, and magic. It is artistic, spontaneous, a trickster, innocent, humorous, extraordinary, a divine clown, curious, co-creator of the higher life, transparent, and communicative. It is a G.A.P. kin so it resides on the ladder between the double helix and is an anchor point that creates the double helix spiral.

It’s analog is Yellow 3 Venus; beauty, art, and elegance.

It’s guide power is Blue 3 Eagle; creative vision from the Mind

It’s antipode is Red 3 Dragon; nurture, being, and birth

It’s Hidden Wisdom is White 11 Dog; Spectral love, loyalty, and heart. These things may dissolve for you today.

The 5GForce is Red 11 Moon or Spectral, dissolving, changing emotion. I absolutely feel that today.

The Time Portal literally located on the planet; 30 degrees north–150 degrees west in the N. Pacific between Baja, CA and Hawaii. Click the link to see the location.

https://goo.gl/maps/CkH9uwwhQZiRk2xD7

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that. I agree with social distancing but not the masks. Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

We Meditate in Order to Focus. Our Thoughts are Seeds.


The planet on the right is Jupiter. Meditation is channeling and focus is targeting. Those are Yellow 7 Seed Attributes. We meditate within our bodies and then our body/mind interacts with MIND all around us. We can choose what we let in and what we don’t. Activating the power of our minds is frankly the only way we’re going to get out of this mess of others controlling the human race. We’ve let this happen by default.

Yellow 7 Seed resonates AWARENESS of the context within which we live and have our BEing. A physical seed is a DNA seed packet that drops to the earth and sprouts. A woman’s egg is a DNA packet that drops in the uterus, is fertilized and creates a human. That is an exact analogy to our MIND seed packets that we drop in the ether and they literally sprout. I’m asking you to meditate on the LITERAL nature of THE MIND and TIME as DNA and the power of Life Force that it has.

Look at the phenomenal plant life on earth that came from a tiny physical seed! Now imagine that 100 times or more with the power of human intention backed up by the timeless universe with regard to our thoughts and feelings. You may assert your positive gratitude and happiness path a bit harder instead of indulging in anger and pettiness on social media next time. The whole planet needs to PIVOT on that. I deactivated my Twitter account. That thing is TOTALLY negative. So is T.V. Negative mindset is the most destructive thing on the planet and we should not be part of it. In essence, we’re destroying ourselves if we do but maybe that’s what some people want because they literally don’t believe that Love and Goodness exist in the Universe. They don’t believe there is a God. Ok, then!

This process is called ATTUNEMENT and is also an attribute of RESONANT TONE 7. I am a Reiki Master and teach Reiki classes and do attunements for my students. Their mind and body has become aware of their Qi or Ki and now they have learned how to FOCUS their QI to heal themselves and others. It’s not much different than tuning up a musical instrument or the singing voice. I am also a degreed musician. The musician and actually all artists are athletes in that our creative expression comes through our body. You have to be in shape and in tune with your biorhythm to do well in your craft. That’s also the case with bodyworkers.

Being a Reiki Practitioner is like being a gardener organizing and tending to their garden. Each client is a Seed that wants to get comfy in the soil of their body and SPROUT! ReiKI is like the SUN.

The 5GForce today is Yellow 7 Warrior, the GUIDE POWER. That’s odd. The Moon was in Sag and is now in Capricorn so there is some affinity today between Jupiter and Saturn on every level.

  • The Theme in the middle is Yellow 7 Seed, Valine
  • Analog is Blue 7 Eagle, Arginine
  • Guide Power is Yellow 7 Warrior, Histidine
  • Antipode of White 7 Wizard, Lysine
  • Hidden Wisdom is Red 7 Earth, Phenylalanine.

The pentagon in histidine is tetrahedral which is the Hydrogen molecule. It appears to me that Jupiter has had a major role in making sure hydrogen is distributed to planets that are going to evolve life. Saturn has the hexagon which is in Phenylalanine. JUPITER is the mediating planet today.

Knowing and Admitting Your Feelings About a Situation is Really Important


Welcome to another day in the matrix where synchronicity with All That Is are the road signs, as long as we’re paying attention. This blog is an attempt to free your VISION so that you glide easily between inner vision of yourself and your body and the outside world, or what we perceive as the outside world. I believe it’s actually ALL ONE Big Mind in the illusory hologram that we perceive with our five senses.

For thirty years I’ve witnessed and been personally involved in amazing, unmistakable synchronicity that can be explained no other way. So have countless others. But there is still this outside screaming chorus of CONTROL from the spiritually ignorant, greedy, bitter victims and psychopaths that would have us believe THEY are in control of the Matrix. Yeah, no. But in this local universe they are free to try up to a point. I can tell you that the E.T.’s helping us have time and again shut down our nukes and that will continue. They are not allowed to destroy the human race or the Earth. It’s in the contract.

The Matrix command and control is Galactic Center. We live in a Grand Universe that is organized according to Love and Light but because of free will, dissent, evil, violence, resistance and mischief are allowed to exist. There are 300 species of E.T. alone on THIS planet, underground, among us as humanoids, and in our local solar system. They are NOT a threat to us but we are EVER SO MUCH to them because of our unwillingness to control our drama and bodies. Humans need to get with the program and become CO-CREATORS instead of reacting like little children all the time. E.T.’s are just people. Hopefully soon all will be disclosed and the intelligence they’ve left us will come to the surface.

Knowing our Feelings is EMPOWERING!

Today is Red 5 Moon or Radiant Methionine which is the START CODON for the tRNA in all RNA sequences. It’s attributes are; purification, flow, and universal water. I talked extensively about water, hydrogen, and the tetrahedron yesterday without realizing that TODAY was the Water archetype. It’s analog is White 5 Dog which is Radiant Love. Red 5 Earth is the Guide Power, Blue 5 Storm is the Antipode and Yellow 9 Human is the Hidden Wisdom. The nutshell of that is, our bodies and feelings are bonded to Love and Loyalty. That truth is our accurate NAVIGATION in the matrix. Notice I didn’t say we ARE our feelings or that we should SIT IN our feelings. They are just road signs and then should be released. But don’t ignore the road signs in the Matrix or you’ll go off your rails. Our challenge and gift is to use that to catalyze SELF-GENERATION and INTERNAL ENERGY or QI. As Solar children, children of the Sun and the earth, our wisdom is to accept who we are in this incarnation. Follow the Sun cycles and the Earth cycles, not humans and their institutions. We have free will and real influence with other species. We are creators and holders of the chalice, the Holy Grail. We are vessels of a higher power and some would like to steal that from us. Hold your boundaries with the FOCUS of your mind. Navigate your body and mind. The Universe has your back. It’s not useful to offload your story or drama onto other people right now. Just align your daily behavior with your internal power. People can feel it. Act more, talk less.

MOLECULAR LINE-UP

  • Red 5 Moon is the theme; Methionine, the start codon
  • White 5 Dog is the analog; Aspartic Acid
  • Red 5 Earth is the Guide Power; Phenylalanine
  • Blue 5 Storm is the Antipode; Tryptophan and a type of Stop Codon
  • Yellow 9 Human is the Hidden Wisdom; Glutamic Acid

Just for fun, look at how similar the scientists depiction of a tRNA molecule looks to the Tzolkin Themeplex. Again, synchronicity. Just flip it to the right. The antipode/anti-codon is on the left.

Contains attachment site at the 3’ end for an amino acid. Contains a loop with the ___________. Fig ’ 5’ The anticodon base-pairs with a complementary codon on mRNA. If the codon on mRNA is UUU, a tRNA with a. ______ anticodon and a tRNA carrying phenylalanine will bind to it. The anticodons of some tRNAs recognize more than one________. Why? Because the rules for base pairing between the third base of the codon and anticodon are ________ (called______________).