Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that. I agree with social distancing but not the masks. Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

We Meditate in Order to Focus. Our Thoughts are Seeds.


The planet on the right is Jupiter. Meditation is channeling and focus is targeting. Those are Yellow 7 Seed Attributes. We meditate within our bodies and then our body/mind interacts with MIND all around us. We can choose what we let in and what we don’t. Activating the power of our minds is frankly the only way we’re going to get out of this mess of others controlling the human race. We’ve let this happen by default.

Yellow 7 Seed resonates AWARENESS of the context within which we live and have our BEing. A physical seed is a DNA seed packet that drops to the earth and sprouts. A woman’s egg is a DNA packet that drops in the uterus, is fertilized and creates a human. That is an exact analogy to our MIND seed packets that we drop in the ether and they literally sprout. I’m asking you to meditate on the LITERAL nature of THE MIND and TIME as DNA and the power of Life Force that it has.

Look at the phenomenal plant life on earth that came from a tiny physical seed! Now imagine that 100 times or more with the power of human intention backed up by the timeless universe with regard to our thoughts and feelings. You may assert your positive gratitude and happiness path a bit harder instead of indulging in anger and pettiness on social media next time. The whole planet needs to PIVOT on that. I deactivated my Twitter account. That thing is TOTALLY negative. So is T.V. Negative mindset is the most destructive thing on the planet and we should not be part of it. In essence, we’re destroying ourselves if we do but maybe that’s what some people want because they literally don’t believe that Love and Goodness exist in the Universe. They don’t believe there is a God. Ok, then!

This process is called ATTUNEMENT and is also an attribute of RESONANT TONE 7. I am a Reiki Master and teach Reiki classes and do attunements for my students. Their mind and body has become aware of their Qi or Ki and now they have learned how to FOCUS their QI to heal themselves and others. It’s not much different than tuning up a musical instrument or the singing voice. I am also a degreed musician. The musician and actually all artists are athletes in that our creative expression comes through our body. You have to be in shape and in tune with your biorhythm to do well in your craft. That’s also the case with bodyworkers.

Being a Reiki Practitioner is like being a gardener organizing and tending to their garden. Each client is a Seed that wants to get comfy in the soil of their body and SPROUT! ReiKI is like the SUN.

The 5GForce today is Yellow 7 Warrior, the GUIDE POWER. That’s odd. The Moon was in Sag and is now in Capricorn so there is some affinity today between Jupiter and Saturn on every level.

  • The Theme in the middle is Yellow 7 Seed, Valine
  • Analog is Blue 7 Eagle, Arginine
  • Guide Power is Yellow 7 Warrior, Histidine
  • Antipode of White 7 Wizard, Lysine
  • Hidden Wisdom is Red 7 Earth, Phenylalanine.

The pentagon in histidine is tetrahedral which is the Hydrogen molecule. It appears to me that Jupiter has had a major role in making sure hydrogen is distributed to planets that are going to evolve life. Saturn has the hexagon which is in Phenylalanine. JUPITER is the mediating planet today.

Knowing and Admitting Your Feelings About a Situation is Really Important


Welcome to another day in the matrix where synchronicity with All That Is are the road signs, as long as we’re paying attention. This blog is an attempt to free your VISION so that you glide easily between inner vision of yourself and your body and the outside world, or what we perceive as the outside world. I believe it’s actually ALL ONE Big Mind in the illusory hologram that we perceive with our five senses.

For thirty years I’ve witnessed and been personally involved in amazing, unmistakable synchronicity that can be explained no other way. So have countless others. But there is still this outside screaming chorus of CONTROL from the spiritually ignorant, greedy, bitter victims and psychopaths that would have us believe THEY are in control of the Matrix. Yeah, no. But in this local universe they are free to try up to a point. I can tell you that the E.T.’s helping us have time and again shut down our nukes and that will continue. They are not allowed to destroy the human race or the Earth. It’s in the contract.

The Matrix command and control is Galactic Center. We live in a Grand Universe that is organized according to Love and Light but because of free will, dissent, evil, violence, resistance and mischief are allowed to exist. There are 300 species of E.T. alone on THIS planet, underground, among us as humanoids, and in our local solar system. They are NOT a threat to us but we are EVER SO MUCH to them because of our unwillingness to control our drama and bodies. Humans need to get with the program and become CO-CREATORS instead of reacting like little children all the time. E.T.’s are just people. Hopefully soon all will be disclosed and the intelligence they’ve left us will come to the surface.

Knowing our Feelings is EMPOWERING!

Today is Red 5 Moon or Radiant Methionine which is the START CODON for the tRNA in all RNA sequences. It’s attributes are; purification, flow, and universal water. I talked extensively about water, hydrogen, and the tetrahedron yesterday without realizing that TODAY was the Water archetype. It’s analog is White 5 Dog which is Radiant Love. Red 5 Earth is the Guide Power, Blue 5 Storm is the Antipode and Yellow 9 Human is the Hidden Wisdom. The nutshell of that is, our bodies and feelings are bonded to Love and Loyalty. That truth is our accurate NAVIGATION in the matrix. Notice I didn’t say we ARE our feelings or that we should SIT IN our feelings. They are just road signs and then should be released. But don’t ignore the road signs in the Matrix or you’ll go off your rails. Our challenge and gift is to use that to catalyze SELF-GENERATION and INTERNAL ENERGY or QI. As Solar children, children of the Sun and the earth, our wisdom is to accept who we are in this incarnation. Follow the Sun cycles and the Earth cycles, not humans and their institutions. We have free will and real influence with other species. We are creators and holders of the chalice, the Holy Grail. We are vessels of a higher power and some would like to steal that from us. Hold your boundaries with the FOCUS of your mind. Navigate your body and mind. The Universe has your back. It’s not useful to offload your story or drama onto other people right now. Just align your daily behavior with your internal power. People can feel it. Act more, talk less.

MOLECULAR LINE-UP

  • Red 5 Moon is the theme; Methionine, the start codon
  • White 5 Dog is the analog; Aspartic Acid
  • Red 5 Earth is the Guide Power; Phenylalanine
  • Blue 5 Storm is the Antipode; Tryptophan and a type of Stop Codon
  • Yellow 9 Human is the Hidden Wisdom; Glutamic Acid

Just for fun, look at how similar the scientists depiction of a tRNA molecule looks to the Tzolkin Themeplex. Again, synchronicity. Just flip it to the right. The antipode/anti-codon is on the left.

Contains attachment site at the 3’ end for an amino acid. Contains a loop with the ___________. Fig ’ 5’ The anticodon base-pairs with a complementary codon on mRNA. If the codon on mRNA is UUU, a tRNA with a. ______ anticodon and a tRNA carrying phenylalanine will bind to it. The anticodons of some tRNAs recognize more than one________. Why? Because the rules for base pairing between the third base of the codon and anticodon are ________ (called______________).

The Most Logical Explanation is that CV2 Comes from a Laboratory.


The well-known Norwegian virologist Birger Sørensen and his colleagues have examined the corona virus. They believe it has certain properties which would NOT evolve naturally. These conclusions are politically controversial, but in this interview he shares the findings behind the headlines.

Here is the rundown at this link.: https://archive.vn/Wmj9p

It’s an excellent article.

A few books I read

Mercury is Retrograde and Self-Existing Wind is in perfect synchronicity with it.


White Wind IS the amino acid Glycine

The attributes of White Wind are communication, breath, and spirit. That pretty much defines the attributes of Mercury as well which rules Gemini. Tone 4 is Self-Existing, introvert, self-generating and that is also the exact energy of retrograde motion so as usual, our local solar system is right in line with multi-dimensional time.

The mediating planet today between White Wind and its analog Red Earth is Uranus which is retrograde in Taurus. With that movement we have a rehashing and rethinking about our financial situation and some boredom with routine. Taurus is cardinal earth so it’s very easy for them to get stuck in a rut.

Our 5th dimensional GForce is White 10 Mirror or planetary reflection. So in addition to humans reflecting with White 4 Mirror, the planet is reflecting on herself also. GAIA does have a mind of her own whether people believe it or not. This is in synchronicity with the Cancer placements right now, the Solstice and the New Moon this weekend.

The lineup for the themeplex is to the right. White 4 Wind (glycine) is the theme in the center with it’s analog Red Earth (phenylalanine) to the right. Those two together have a vibe of evolving and synchronizing based on COMMUNICATION. So between friends, the issue of love and understanding will loom large right now but bc Mercury is retrograde there will be a lack of affinity. I’m seeing that play out around me right now. Boundaries are in order and letting the mud settle.

We’re guided by White 4 Mirror (tyrosine) so again, if things are chaotic, sit, reflect and be quiet. Let the relationship or issue settle out with no more talking between parties for now. Examine your own motives by yourself or in what direction you want to head if the other person is pushy and you’re just watching it play out. There’s supposed to be reciprocation between humans, like a teeter totter, equal time talking and listening.

The antipode position challenging is Yellow 4 Human (glutamic acid) evolving. I have had a spate of women (3 of them) strongly asserting themselves and their needs into my space this week without consideration of me. It’s unusual for me because I have very firm boundaries and I’m busy with my projects. One assumes that others see that and would be considerate. I’m not sure what that’s about except humans are not programmed to love and believe in themselves, lack confidence and tend to want attention and coddling, even as adults. Then they offload into another’s space. I’ve see that all of my life and I don’t do it or cooperate. It’s co-dependent. So do watch out for people who are offloading and projecting their needs into your space as though you don’t exist. They lack reciprocation social skills because of low self-esteem.

Maybe I’m just conservative and believe in being appropriate with acquaintances, not too familiar. There are odd communication boundaries these days where people think they’re your friend just because you commented once in social media with regard to them. Of course we’ve never met in person.

The hidden wisdom is Blue 10 planetary Storm so I believe the weather will turn after dusk tonight and we’ll get storms. The earth is programmed by the Tzolkin as well. There is some light body activation, ascension issues, and open-mindedness here.

THE MOLECULAR PERSPECTIVE

They synchronicity here is AMAZING. Phenylalanine (Uranus and Aquarius) are on the move and evolving HARD! My son is Red Earth and is right in the thick of it. Look at how phenylalanine has a direct relationship with both Tyrosine, the Guide Power today and tryptophan (has the pink on it), the hidden wisdom! The hexagon is prominent in both again too. Also, so much Carbon and catalyzing of energy for Earth living.

Wednesday. Self-create or React? Act or RE Act?


RE-acting is mimicry. Monkeys and parrots mimic. Humans also mimic unless they are mentally mature. Babies learn by mimicking but adults learn by creating. Humans are addicted to mimicry because of a lazy streak usually due to unresolved childhood issues. They’re still grieving parenting they didn’t get. That ship has sailed. You can parent yourself with the help of the universe and rival your parents. Don’t you want to win? I want my son to win over any mistakes his father and I made. Self-Creating, self-generating (Blue Storm tribe), Acting is all ART and comes from your Magic Nation or imagination.

Think of these two as a teeter tooter where you are deciding whether to go one route or another. In this case, are you going to DIY and send up a plan in your mind or are you going to continue your normal REACTIVE route where first you have to pull in something from outside of you such as another’s idea, T.V. , Twitter or Instagram and react to it, or are you going to sit quiet or workout, meditate, listen to your body and intuition and create your own plan from within yourself?

We are each at the precipice right now. Tone 2 is stabilizing by polarizing. It’s a simple choice; Self create, or React? Self create or React? The first one is INtegrity the second one is wash, rinse, repeat for your entire life and wastes everyone’s time and resources and nothing original is added to the planet.

Self-creating and acting involves:

  • Body care-organizing fresh food
  • Physical Activity
  • T.V. OFF
  • Water intake
  • Hand held device-limited
  • Organizing your money and bills
  • Meditation up to an hour a day
  • Boundaries with people who vampire your energy
  • No large group activities right now. Stay away

All of that is stabilizing. Stabilize yourself and don’t look outside of yourself to get someone or something to do it for you. Your MIND, your BRAIN is a magnet that turns your body into a magnet. It’s literal. The media is trying to program your mind to give your authority and magnetism over to them. Don’t let them in. Our immune systems, bodies, and minds are the province of US and the Universe has our backs. Freedom and balance are universal law. We are supposed to be evolving in freedom and balance otherwise we’ll be programmed to go over the cliff. That gets rid of the weak-minded ones. They obey.

5GForce: Yellow 12 Sun; I dedicate in order to enlighten. Universalizing Life, I seal the matrix of universal fire with the crystal tone of cooperation. I am guided by the power of free will.

SCIENCE STUFF

Yellow 2 Sun Themeplex

  • THEME; Yellow 2 Sun is the Stop Codon
  • ANALOG: Blue 2 Storm or Tryptophan
  • GUIDE POWER; Yellow 2 Human or Glutamic Acid has the extra carbon-hydrogen molecule which humans needed to evolve once we were on the planet
  • HIDDEN WISDOM: Red 12 Cysteine or Red Dragon. Notice the Sulfur molecule in Red Dragon. The Earth began in sulfur and Red Dragon is the first tribe.

What is the Binary Triplet Configuration in the Tzolkin?


abstract technology science concept DNA binary on hi tech blue background

What is 13? 3×4+1.

13 is the triplet 3 x 4 = 12 +1 (Earth and Humans (Yellow Human is tribe 12) plus a magnetic tone 1 pulse leading up to the overtone or Power of 5. Tone 5 is the radiant overtone which leads us to the 5th dimension, the galactic 5GForce which is pulsing in a big way right now.

13 is the triplet part of the binary triplet configuration in the Tzolkin which is perpendicular. The Binary (2-fold) is vertical. The zone of transformation for the DNA is in the middle and it transforms via the polarity zone.

The Tzolkin is way past binary code so I’m having to slow my mind down to think in their language. But it does translate easily on the 3D level. However, because it’s Multidimensional in it’s expression, the math is changing. The info. I have says the genome is digital but it’s not binary.🧐 Well, it is in the Tzolkin when you combine it with the Triplet in 13:20! They don’t have that info.🥳 Copyright, Lisa K. Townsend.

Jose Arguelles, Author of The Dreamspell and Earth Ascending.

Saturday. Dissolving Walls with Histidine


Histidine is an amino acid that is responsible for tremendous bursts of energy from every cell in our bodies. With it’s analog Alanine, it affects the function of our muslces. It’s a survival, thriver amino acid that has allowed the human race to accomplish amazing feats and is tied to our cortisol levels which affects energy level.

SCIENCE CORNER

Effects of Histidine and β-Alanine Supplementation on Human Muscle Carnosine Storage

Carnosine is a di-peptide molecule, made up of the amino acids beta-alanine and histidine. It is highly concentrated in muscle and brain tissues. Carnosine and carnitine were discovered by Russian chemist Vladimir Gulevich.

https://pubmed.ncbi.nlm.nih.gov/28106620/

Also in this themeplex we have White Worldbridger or Threonine as the antipode and Red Serpent or Serine as the Hidden Wisdom. There is an amazing amount of carbon in all of these molecules which helped humans evolve flesh onto our bones.

These molecules have very strong synchronicity with each other which is another sign that their line-up in the Tzolkin Harmonic Code is connected to our lives on earth. Through a binary triplet configuration and the 13 Tones of Creation, these 3D proteins fold into everything in our world. Once the scientists accept that what is esoteric underpins the nature of things, this information will be tested and processed to create a real healthcare system with a philosophy of Whole systems.

Classical Binary Bit; 1-3D. Qubit; 4-5D.


This is a great image of a classical bit (0’s and 1’s) vs. Qubit. What does this have to do with DNA? Everything. Our ancient human 64-bit divination programs based on culture are DNA information left on the planet by our ancestors that helped us evolve here. There are many different 64-bit programs all over the world.

The 64 bit DNA illumination from other cultures IS THE BASIS for our current 64 and 32-bit computer programs. Is our tech trying to change and program our DNA? LOL😆 Yahhhhh. Is it altruistic or sinister? It depends on the soul state of the individual using it. You can use any tool for lightwork or dark work. That’s what we’re learning about on Earth.

The SPACE between the 0 and the 1 is what computer programmers want to avoid. It’s the mysterious electromagnetic twilight zone that can blow your circuits and I believe they have figured out how to do it. Still, sometimes computers do crash and their speed and capability are very limited. So, like our current perception of our DNA it is dualistic. We’re in the dark ages on Earth folks.

The other qubit image is 4-5D so we get to uplevel to 4th and 5th dimension which is TIME and MIND or TIMEMIND. SPACETIME is 1-3D. This is my concept. I just created the word Timemind.© as I was typing. Copyright.🙏

I guess the quantum computers are working and it may take a quantum computer to illuminate or communicate the 13 Tones of Creation. I’ve got the Tzolkin figured out in classical binary. JOSE HAD IT FIGURED OUT he just didn’t want to sit there and write out all the 0’s and 1’s. 😆 which I am willing to do. There aren’t just 260 of them There are 260 x 5 lines of 0’s and 1’s as the Tzolkin Code, so 1300 lines of classical binary code. Gee, what fun.🤓🥳

But as you and I both know, each kin has a creative tone 1-13 in front of it. That’s not JUST a number or a musical note which would be easy to write in the classical binary. They are something else in quantum.

Sunday. A vision for empowering, commanding, radiant Love, Loyalty, and Heart. White 5 Dog


White 5 Dog; 5 Aspartic Acid

Code0-19: 18:10:5:70

Mediating planet is Mercury which is currently direct.

5GForce; White 9 Dog. Solar, Intention, realization and pulsing of love, loyalty and heart. Get woke!

This is a day for acting and speaking from a flowing open heart that then looks into the mirror guided by clarity, truth, discernment, and commitment. Once that vision is clear from within you, according to your passion and your rational mind, it’s uploaded to Galactic Center Via our Sun.

This it the themeplex today.

I don’t usually use these because I’m not crazy about the art but it does help you see the archetypes and their relationship to one another. The theme is in the center. It’s the nucleus of a DNA molecule. On the right is the analog which is sort of co-equal with the theme and is in the position of the attachment site on the tRNA molecule. Above is the guide power or the D-Arm of the tRNA. On the left is the antipode or the anticodon tRNA on the 3′ and 5′ end of the tRNA. And the hidden wisdom is in the T-arm position. This is my theory. I’m still working on proving it.

The Amino acids analog with these archetypes today are;

  • Aspartic Acid,
  • Methionine, the start codon,
  • Tyrosine, the
  • Stop Codon and
  • Asparagine.

It’s very significant that we have a start and stop codon in the same Tzolkin themeplex. The start and stop codon begin and end the mRNA translation in the sequence. Intuitively, thinking about both the function of the amino acids, their placement, and the attributes of the Tzolkin archetypes, I’d say that the DNA programming of radiant, overtone love from Galactic center is working on flowing and evolving in every nucleus of every DNA cell in every human body today. We need to roll with it, look…in…the…mirror and see ourselves through the eyes of love. Or, see ourselves the way God sees us; as her/his perfect children.

If you are a parent, you know that when your baby is born, they are perfect and you are in love. It was like that for me as a mother and my baby is now 21. I still adore him and want his happiness and health and want him to find the mate he needs and the career he needs to be of service on the planet more than anything else. Now imagine how our Creator feels about us only a bazillion times more. Yes, I see his flaws but forgive them and am patient with them. God’s love IS our love. That’s the only way we have it and it needs to break our hearts open with passion, vision, and forgiveness. We are one human family.

The function of the stop codon, YELLOW SUN, or ZERO is to upload all of that energy like an email to galactic center as a status report. That’s going on right now. From noon-sunset, up it goes. Once we hit dusk it’s Blue 5 Monkey, time to play, relax, hang out until midnight. Happy Sunday.

SCIENCE CORNER