Sunday-The Sun is Now in Scorpio (in Sync with Wizard/Serpent Mediated by Maldek


The Sabian Symbols are ancient just as astrology is and come from the astrological line-ups for the day. Both come from astronomy or the observation of the planets. Both are based on the energies of what we now call the Interplanetary Holon. I have dialed up many people with the Sabians and find their interpretation of planetary placement at birth to be more accurate than modern astrology. Check this out for today. And be sure and put yourself in the Sabian Calculator and see if it rings true. Mine does. I’m giving you a synopsis below but do read the info. or watch the videos on this link. It’s a good way to spend a Sunday and see the truth about your alignments and those close to you.

I have shown you the synchronicity between the astrological Sabian Symbols and the Mayan Oracle

Body Holon-tRNA evolving in a 5 membered cell in every cell of our bodies

  • Theme is 2Lysine or White 2 Polar Wizard: Timelessness
  • Analog is 2Serine or Red 2 Polar Serpent; Sex
  • Guide Power is 2Threonine or White 2 Polar WB; Change-Death
  • Antipode is 2Valine or Yellow 2 Polar Seed; Flowering
  • Hidden Wisdom is 12Isoleuicine or Blue 12 Crystal Hand; Accomplishment
  • The 5GForce is 12Threonine or White 12 Crystal WB; Communal Change/Death.

Interplanetary Holon

“Sabian Symbols Calculator – sabian mysteries” https://www.jamesburgess.com/sabian-calculator.html

  • The Sun is in Scorpio2. The degree is nostalgia in sync with the mediating planet Maldek and the analog; Red 2 Serpent.
  • The Moon is in Gemini15; confirmation and validation in sync with Yellow 2 Seed, the antipode.
  • Mercury in Libra 14; Taking a break in sync with the guide power, White 2 WB.
  • Venus in Sag19; raise your standards for the vulnerable by following your Higher Self not your lower self which always invokes LACK or sacrifice. We need to pivot to abundance mindset for everyone, in my opinion in sync with the Hidden Wisdom; Blue 12 Crystal Hand and the GForce White 12 WB.
  • Mars in Libra26; Mastery. In sync with Tone 2 and White 2 WB in the oracle today.
  • Jupiter is in Aquarius23-the discipline of Self-Control in sync with the theme; White 2 Polar Wizard and the antipode Yellow 2 Polar Seed.
  • Saturn is in Aquarius 8-Creative Power of Admiration in sync with Blue 12 Hand
  • Uranus is in Taurus14; Simple Pleasures in sync with the antipode.
  • Neptune is in Pisces 21; Training in Optimism in sync with the Hidden Wisdom

Here is an example of one of the Sabian Videos. We each have twelve of these. This is my N. Node in Cancer. The dark shadow is the burden of leading or power to teach in the public eye. Strong confidence to teach alignment and balance is a gift that when I’m ready, I may have to bear.

Friday-Our DNA is From the Cosmos so it’s Not Hard to be a Cosmic Human


We are at the end of the Yellow 13 Sun Wavespell. We’ve gone from cosmic enlightenment to cosmic freewill.

Body Holon

  • Theme is 13Glutamic acid or Yellow 13 Cosmic Human: cosmic free will.
  • Analog is 13Isoleucine or Blue 13 Cosmic Hand: cosmic accomplishment and healing
  • Guide Power is 13Histidine or Yellow 13 Cosmic Warrior; intelligence
  • Antipode is 13Glycine or White 13 Cosmic Wind: cosmic spirit
  • Hidden Wisdom is 1Methionine or Red 1 Magnetic Moon; Magnetic Feeling of Universal Flow
  • 5GForce is 1Leucine or Yellow 1 Magnetic Star; Magnetic Beauty

Interplanetary Holon

The mediating planet is EARTH.

Today’s Coordinate is 13:12:13:52
  • The Moon spends the day in stable, steady, sensual Taurus. (Synchronicity with the Theme/Analog)
  • Today’s Mercury-Ceres trine supports healthy conversations and thinking. (Synchronicity with Red 1 Moon)
  • The Moon’s square to Jupiter midday can have the effect of magnifying our feelings and attachments, perhaps disruptively.
  • It might stimulate restlessness which may very well lead to indulgence.
  • However, the Moon-Pluto trine this afternoon is far more deliberate and decisive.
  • We appreciate gentle challenges, as we feel alive and vital as we meet them.
  • The planets mediating in the Theme-plex today are Earth, Saturn, Uranus, and Mercury.

Thursday; Evolution of 10 Cysteine (Red 10 Planetary Dragon)


Cysteine is the Theme; Red Dragon and Methionine is the Guide Power; Red Moon. The analog is 10 Tyrosine; White 10 Planetary Mirror. They are related to each other in 3D clenching Amino Acid sequences.

Their real power lies in multidimensional TIME controlled by our MINDS. Red Dragon tribe is blood memory and primordial mother. The alligator is progeny of Red Dragon and they are very good mothers, maybe the best. Remember mammals evolved from reptiles!

Cystathionine β-synthase (CBSis a unique heme- containing enzyme that catalyzes a pyridoxal 5′-phosphate (PLP)-dependent condensation of serine (Red Serpent, Red Dragon’s progeny) and homocysteine to give cystathionine. Synchronicity.

Cysteine, Tyrosine, Methionine, Asparagine, and 4 Stop Codon.

With the Start Codon and the Tone 4 Stop Codon in there, this is a themeplex taking a reading on our birth DNA via our Mother. Tone 4 is self-existing so it applies to each individual and the soul lessons they’ve learned from their mother.

We are in a new Harmonic 26; Cosmic Input; inform the flowering of Presence which speaks to Yellow 13 Cosmic Seed which will end this 4-day cycle. It’s ruled by Jupiter and there is much activity on Jupiter right now so I’m sure this has something to do with it. I posted 2 events on this blog about it.

The 5GForce today is Blue 4 Self-Existing Storm and so this is independent self-generation being tracked in each person. How are you doing with that?

This is a test day. You can tell where you are by what you’d say you’ve learned from your mother no matter what your relationship is to her. We’re not obligated to like our mother’s and many mother’s don’t get along very well with their grown children. But you can’t really do a cut off. The bond is too great and therefore, you do need to keep learning about who you are or want to be as a soul by looking in the mirror of your mother. The analog is White 10 Planetary mirror and there is no stronger planetary mirror than your mother. I think these are the cutest pictures ever.

Thursday; 3Electric Lysine


DNA (every cell of your body) IS TIME (the Tzolkin Calendar). A Kin is a day and a person.

When they say articulations on this image they mean joints;

  • Right ankle-Tone 1
  • Right knee-Tone2
  • Right hip-Tone 3
  • Right wrist-Tone 4
  • Right elbow-Tone 5
  • Right shoulder-Tone 6
  • C7 vertebrae-Tone 7
  • Left shoulder-Tone8
  • Left elbow-Tone 9
  • Left wrist-Tone 10
  • Left hip-Tone11
  • Left knee-Tone 12
  • Left ankle-Tone 13

I’m going to review something quickly for you today; the 0-19 Code and the 20 Archetypes on our hands and feet.

We are currently on the Left Truth Hand. Starting with the thumb; Dog 10, Monkey11, Human12, Skywalker13, Wizard14. (Today we are on Tribe 14). These kin are outspoken, tell the truth, and are prophetic. The Truth is not a popular commodity on earth.

Left Sky Foot starting with the Great Toe is Blue Eagle15, Yellow Warrior16, Red Earth17, White Mirror18, Blue Storm19. These kin have big vision and expect all of us to cooperate with their vision so things can be perfected.

Right Fire Hand starting with the Thumb is Yellow Sun 0/20, Red Dragon1, White Wind2, Blue Night3, Yellow Seed4. These kin rule the roost with their fire and to cross them means getting burned. They are domineering.

Right Blood Foot starting with the Great Toe is Red Serpent5, White World Bridger6, Blue Hand7, Yellow Star8, Red Moon9. These kin are very provincial and dedicated to family and ancestry above all else. They are DNA myopic.


Theme is 3Lysine; Lysine appears to help the body absorb calcium, and it plays an important role in the formation of collagen, a substance important for bones and connective tissues including skin, tendons, and cartilage. It also blocks arginine (Blue Eagle whose analog is Yellow Seed) which helps create cold sores. Most people get enough lysine in their diet. It is a treatment for cold sores, reduces anxiety, improves calcium absorption, and promotes wound healing by helping to create collagen.

Analog Support is 3Serine; One of the Serine’s functions is to help form the phospholipids which are necessary for creating every cell in the human body. In addition, this amino acid is involved in the functioning of RNA and DNA, in the muscle formation as well as in the maintenance of a proper immune system

The Guide Power for another hour is 3Tyrosine; Tyrosine is a nonessential amino acid the body makes from another amino acid called phenylalanine (RED EARTH which is tribe17 and precedes White Mirror, tribe18 in the Tzolkin ). So first comes phenylalanine in the body and then tyrosine and first comes Red Earth in the Tzolkin and then White Mirror. You See?!

It is an essential component for the production of several important brain chemicals called neurotransmitters, including epinephrine, norepinephrine, and dopamine. White Mirror is about meditation and calming the brain. All of those chemicals calm people down. Bodywork releases all of them as well.

The Antipode this afternoon is 3Valine which is the analog of Blue Eagle (arginine). Notice my comment above about cold sores. Valine is one of three branched-chain amino acids, meaning it has a chain branching off to one side of its molecular structure. Valine helps stimulate muscle growth and regeneration and is involved in energy production.

The Hidden Wisdom is 11Isoleucine. Isoleucine, as one of the branched chain amino acids, is also critical in physiological functions of the whole body, such as growth, immunity, protein metabolism, fatty acid metabolism and glucose transportation. Isoleucine can improve the immune system, including immune organs, cells and reactive substances.

The 5GForce is 11Threonine. Threonine is used to treat various nervous system disorders including spinal spasticity, multiple sclerosis, familial spastic paraparesis, and amyotrophic lateral sclerosis (ALS, Lou Gehrig’s disease).

Monday; The Evolution of Amino Acid Asparagine


Robert Downey Jr. and Caley Cuoco both have this as their Birth Destiny Gateway. I like the both as actors very much.

In the ancient Mayan tradition this is Blue 3 Monkey. It’s attributes are; play, illusion in the matrix and in the hologram, and magic. It is artistic, spontaneous, a trickster, innocent, humorous, extraordinary, a divine clown, curious, co-creator of the higher life, transparent, and communicative. It is a G.A.P. kin so it resides on the ladder between the double helix and is an anchor point that creates the double helix spiral.

It’s analog is Yellow 3 Venus; beauty, art, and elegance.

It’s guide power is Blue 3 Eagle; creative vision from the Mind

It’s antipode is Red 3 Dragon; nurture, being, and birth

It’s Hidden Wisdom is White 11 Dog; Spectral love, loyalty, and heart. These things may dissolve for you today.

The 5GForce is Red 11 Moon or Spectral, dissolving, changing emotion. I absolutely feel that today.

The Time Portal literally located on the planet; 30 degrees north–150 degrees west in the N. Pacific between Baja, CA and Hawaii. Click the link to see the location.

https://goo.gl/maps/CkH9uwwhQZiRk2xD7

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.

Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

We Meditate in Order to Focus. Our Thoughts are Seeds.


The planet on the right is Jupiter. Meditation is channeling and focus is targeting. Those are Yellow 7 Seed Attributes. We meditate within our bodies and then our body/mind interacts with MIND all around us. We can choose what we let in and what we don’t. Activating the power of our minds is frankly the only way we’re going to get out of this mess of others controlling the human race. We’ve let this happen by default.

Yellow 7 Seed resonates AWARENESS of the context within which we live and have our BEing. A physical seed is a DNA seed packet that drops to the earth and sprouts. A woman’s egg is a DNA packet that drops in the uterus, is fertilized and creates a human. That is an exact analogy to our MIND seed packets that we drop in the ether and they literally sprout. I’m asking you to meditate on the LITERAL nature of THE MIND and TIME as DNA and the power of Life Force that it has.

Look at the phenomenal plant life on earth that came from a tiny physical seed! Now imagine that 100 times or more with the power of human intention backed up by the timeless universe with regard to our thoughts and feelings. You may assert your positive gratitude and happiness path a bit harder instead of indulging in anger and pettiness on social media next time. The whole planet needs to PIVOT on that. I deactivated my Twitter account. That thing is TOTALLY negative. So is T.V. Negative mindset is the most destructive thing on the planet and we should not be part of it. In essence, we’re destroying ourselves if we do but maybe that’s what some people want because they literally don’t believe that Love and Goodness exist in the Universe. They don’t believe there is a God. Ok, then!

This process is called ATTUNEMENT and is also an attribute of RESONANT TONE 7. I am a Reiki Master and teach Reiki classes and do attunements for my students. Their mind and body has become aware of their Qi or Ki and now they have learned how to FOCUS their QI to heal themselves and others. It’s not much different than tuning up a musical instrument or the singing voice. I am also a degreed musician. The musician and actually all artists are athletes in that our creative expression comes through our body. You have to be in shape and in tune with your biorhythm to do well in your craft. That’s also the case with bodyworkers.

Being a Reiki Practitioner is like being a gardener organizing and tending to their garden. Each client is a Seed that wants to get comfy in the soil of their body and SPROUT! ReiKI is like the SUN.

The 5GForce today is Yellow 7 Warrior, the GUIDE POWER. That’s odd. The Moon was in Sag and is now in Capricorn so there is some affinity today between Jupiter and Saturn on every level.

  • The Theme in the middle is Yellow 7 Seed, Valine
  • Analog is Blue 7 Eagle, Arginine
  • Guide Power is Yellow 7 Warrior, Histidine
  • Antipode of White 7 Wizard, Lysine
  • Hidden Wisdom is Red 7 Earth, Phenylalanine.

The pentagon in histidine is tetrahedral which is the Hydrogen molecule. It appears to me that Jupiter has had a major role in making sure hydrogen is distributed to planets that are going to evolve life. Saturn has the hexagon which is in Phenylalanine. JUPITER is the mediating planet today.