Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that. I agree with social distancing but not the masks. Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

We Meditate in Order to Focus. Our Thoughts are Seeds.


The planet on the right is Jupiter. Meditation is channeling and focus is targeting. Those are Yellow 7 Seed Attributes. We meditate within our bodies and then our body/mind interacts with MIND all around us. We can choose what we let in and what we don’t. Activating the power of our minds is frankly the only way we’re going to get out of this mess of others controlling the human race. We’ve let this happen by default.

Yellow 7 Seed resonates AWARENESS of the context within which we live and have our BEing. A physical seed is a DNA seed packet that drops to the earth and sprouts. A woman’s egg is a DNA packet that drops in the uterus, is fertilized and creates a human. That is an exact analogy to our MIND seed packets that we drop in the ether and they literally sprout. I’m asking you to meditate on the LITERAL nature of THE MIND and TIME as DNA and the power of Life Force that it has.

Look at the phenomenal plant life on earth that came from a tiny physical seed! Now imagine that 100 times or more with the power of human intention backed up by the timeless universe with regard to our thoughts and feelings. You may assert your positive gratitude and happiness path a bit harder instead of indulging in anger and pettiness on social media next time. The whole planet needs to PIVOT on that. I deactivated my Twitter account. That thing is TOTALLY negative. So is T.V. Negative mindset is the most destructive thing on the planet and we should not be part of it. In essence, we’re destroying ourselves if we do but maybe that’s what some people want because they literally don’t believe that Love and Goodness exist in the Universe. They don’t believe there is a God. Ok, then!

This process is called ATTUNEMENT and is also an attribute of RESONANT TONE 7. I am a Reiki Master and teach Reiki classes and do attunements for my students. Their mind and body has become aware of their Qi or Ki and now they have learned how to FOCUS their QI to heal themselves and others. It’s not much different than tuning up a musical instrument or the singing voice. I am also a degreed musician. The musician and actually all artists are athletes in that our creative expression comes through our body. You have to be in shape and in tune with your biorhythm to do well in your craft. That’s also the case with bodyworkers.

Being a Reiki Practitioner is like being a gardener organizing and tending to their garden. Each client is a Seed that wants to get comfy in the soil of their body and SPROUT! ReiKI is like the SUN.

The 5GForce today is Yellow 7 Warrior, the GUIDE POWER. That’s odd. The Moon was in Sag and is now in Capricorn so there is some affinity today between Jupiter and Saturn on every level.

  • The Theme in the middle is Yellow 7 Seed, Valine
  • Analog is Blue 7 Eagle, Arginine
  • Guide Power is Yellow 7 Warrior, Histidine
  • Antipode of White 7 Wizard, Lysine
  • Hidden Wisdom is Red 7 Earth, Phenylalanine.

The pentagon in histidine is tetrahedral which is the Hydrogen molecule. It appears to me that Jupiter has had a major role in making sure hydrogen is distributed to planets that are going to evolve life. Saturn has the hexagon which is in Phenylalanine. JUPITER is the mediating planet today.