The Facts of Evolution Overstep Fate and Destiny


I’ve bothered to bring ancient wisdom and systems of organizing and seeding DNA on Earth down to the molecular level because of free will guiding evolution. The attribute of free will is manifested by the Yellow Human tribe. Up until now, evolution has either been esoteric and in the realm of New Age Religion or in the lab with the reductionist geneticists using Crispr to slice and dice our DNA.

All religions have been a step forward for humans except for the superstitious parts that require no critical thinking. Generally you have a prophet, a seer, a visionary and a teacher. The new age movement has plenty of those types and unfortunately there is usually some strong, intelligent woman behind the Kings throne to keep him socially cued in. I still see it everywhere in 2020 and she still has to be beautiful and hang on his arm. She is capable of being the leader, but even in the New Age religion, men are men. They are egos that need to try to get territory and dominate because generally speaking, they’re not as strong as women. We tend to dominate this planet, walk into a room even with our shirts on and the men’s mouths drop open. Women have tremendous power just by our physical presence. That’s not the effect men have on women but we are most definitely paying attention and appreciate beauty. Well, I am. I love the line on “Big Bang Theory” where Leslie Winkle says, “Come for the breasts, stay for the brains”. That’s gold. Most men don’t stay for female brains unless they have brains themselves but being men, they need to feel dominant so many times will pick a woman less intelligent than him. Smart women still end up alone much of the time no matter how they look.

On Earth, we still have a problem with the subconscious programming of gender roles seeded in us by our parents generation who went through tremendous trauma to survive the cabal and their nefarious lies and actions. It may take us a while to heal that. In that sense, the New Age religion has been no different.

However, now it’s time to seed a New Science that has at it’s foundation the intended oneness of Mind, Body, and Spirit. Our body IS our Mind and IS our spirit. There is no more degradation of the body, women, sex, and celibacy. We know synchronicity is real and that in the Matrix it’s not about coincidence, ever. Everything happens for a reason.

But today’s Theme, Red 13 Earth TRANSCENDS synchronicity which is an attribute of Tone 13. Cosmic kin transcend, have presence, and endure. We go past what is normally understood or seen and are therefore leaders for the people.

Cosmics have the patience of a great tree. We have enduring patience and perseverance.

Trees are archetypes for EVOLUTION. Red 13 Earth kin navigate the Matrix, transcending synchronicity in order to EVOLVE. The great lesson of this kin is that on Earth we have the power of birth, intelligence, freewill, and SEEDS. Yellow 1 Magnetic Seed in the Hidden Wisdom. All good things on earth come from seeds and we must respect and guard them well. Why? Because seeds are little DNA packets. They are time travelling pods and ensure the future of Earth and our progeny; animals and plants.

Given all of that, the edicts of control, fate, the gods, and destiny are cast out by Earth’s children. We create our own destiny. There is no fate or control of the gods as told to us in Greek myths and others. The Tzolkin doesn’t even control us; it just organizes the Matrix. Everyone’s intentions IN TIME have to coalesce in an orderly fashion or there would be more chaos than there already is.

The analog support is White 13 Wind. This is divine breath, God speaking through evolution. I’m down with that and I’m listening. The Guide Power is Red 13 Dragon, Rupert Sheldrake’s birth theme. He teaches morphic resonance. That melds perfectly with terrestrial evolution and divine inspiration.

Morphic resonance, Sheldrake says, is “the idea of mysterious telepathy-type interconnections between organisms and of collective memories within species” and accounts for phantom limbs, how dogs know when their owners are coming home, and how people know when someone is staring at them.

Sheldrake is inferring what Arguelles inferred all the time; DNA is Time.© There is Interconnection between a DNA organism and collective memories which are time, is the way I would say it. And it’s not mysterious. I have it figured out and I’m putting it in a database to be analyzed. There is rhyme and reason to it.

The antipode is Blue 13 Hand or ongoing healing. I swear I’ve been a healer in every lifetime from planet to planet. I could do it in my sleep. My hands are so attuned to the natural body I can’t fathom calling myself a healthcare worker and not touching the body. It’s so bizarre to me. The boundaries are in my mind. I wouldn’t dream of crossing pa physical boundary with a patient yet sometimes I feel they want me to given the tremendous dysfunction in our society with regard to the body.

No one touches anyone with kindness. When a bodyworker does touch them with kindness and excellent therapy, some are confused. It’s a travesty. The human body is OBJECTIFIED because of our psychotic sick care system and no one is educated about how their body actually works. The doctors aren’t even educated that well. If Church and State can keep you ignorant about the unlimited power of your body to heal, bring pleasure, and accomplish what you wish, they can control you. That has been the status quo and is even now with this planned virus event.

MOLECULAR LINE-UP

The bottom two, isoleucine (Blue Hand) and valine (Yellow Seed) are identical. The power of the Earth and it’s elements TO HEAL naturally is deeply seeded on Earth.

Dr. Chavez Brand New Data on Lab Analysis of the Covid19 Sequence. It’s Not Natural, Therefore a Real Vaccine Cannot be Made.


abstract technology science concept DNA binary on hi tech blue background
Fernando Castro-Chavez is with Lambert Dolphin.

9 hours ago

Whatever They Make and Market is  Either Culling or a Placebo. It’s Not Medicine.

Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.

As you skim, please be sure to read the highlighted areas.-Lisa T.

My posting of today at the Research Gate: “By Sørensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical etiology of the SARS-CoV-2 Spike

https://www.minervanett.no/…/13/TheEvidenceNoNaturalEvol.pdf,

This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.

The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte

SARS-CoV-2 is possessed of dual action capability

Simultaneously it is capable of binding to ACE2 receptors

The likelihood of this being the result of natural processes is very small.”

The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”

A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”

Why does this matter?”

“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”

the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved

“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”

“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”

“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”

“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”

“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”

“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”

“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”

“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”

“a designed mutated strain (initially) lacking the furin cleavage site residues was used”

“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”

“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:

1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!

“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”

“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”

“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”

“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!

“typically the objective of gain of function experiments… a strong indicator of manipulation”

“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”

“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!

Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”

“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”

“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.

“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…

“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!

“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!

“we now add here a forensic analysis”!!!!

Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:

“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”

“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”

“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”

Note:

So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!

But the fight continues as follows:

“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”

And the next one is a “classic” of infamy:

“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”

“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.

“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”

“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”

“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”

“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.

“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”

“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.

So, “the reconstructed historical etiology of the Spike (is) as follows:”

“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”

Conclusion
“We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”

Additionally, in this wretched document;

 https://apps.who.int/…/annual_re…/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/…/annual…/GPMB_annualreport_2019.pdf ),

We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”

Balancing Equality on Earth Calls for Organized Thinking.


Are you able to track your own thoughts and feelings these days? It’s essential that you have organized thinking to make decisions that are safe and to have a healthy body as our society and media are turned upside down with lies and manipulations.  It’s never been much different than that but now it’s very blatant.

The world and the media around us are run by chaotic, addicted, psychopathic, greedy people who we have allowed to get into power. Why? Humans have a weak point that could easily be our downfall and that is believing what we WANT to believe about the outside world and others and not organizing our observations and thoughts to add it up to the truth. Mammals like to be comfy and domestic. We like to clean up our nest, mate, have babies, nurse them, feed them, work and cook. Most people want others to like them although the number is growing that don’t care. We can see that behavior all over the world in every culture and in the animal world. Anything that challenges that comfy mandate we have learned to take with us into DENIAL. That is especially the case if we had a physically or emotionally abusive childhood. The denial, we feel, helps us survive. I remember a client asking me, “Don’t you think it would be easier if I confront my parent about the abuse after we die and I see them on the other side?” This woman is a lovely spiritual person and this was her thinking. She wanted to remain in denial to not deal with something uncomfortable even though the truth would be revealed. If enough of the population does this societies turn into dictatorships with the population very easy to control because they’ve already been willing to be the emotionally walking dead. The answer is NO! don’t wait. Life is to be lived with faith and passion, failure and success. Grab the TRUTH With gusto and be your best self.

The reason we make this mistake is because we are co-creators with tremendous powers of soul, feeling, passion, and art. Meaning we instinctively know that whatever we personally put our minds and bodies to with regard to OUR OWN lives, it changes and manifests what we want. We’re taught that as children by saving our allowance and then buying something and learning how to ride a bike. We gain freedom of movement. People learn at different rates and with different levels of focus but from the time we are babies we learn that by executing certain behaviors we can get what we want. If we didn’t, we’d never get up on two feet and walk in order to go after it.

However, when it comes to OTHERS, that social piece is a big hang-up for humans. The smartest humans also learn from a young age to get what they want and how to manipulate others emotionally and mentally to get it. Those are the young politicians. They don’t mind lying at all and rationalize it big time. They learn to tell people what they want to hear and are rewarded when they get the response, “Now THAT’s what I wanted to hear.” They raise money and proceed into office rhetorically telling people what they want to hear, not the truth. They are opportunists on the backs of public indolence and then we blame them for being what we wanted them to be. THAT IS HAPPENING NOW on a much wider scale with health, our bodies, and politics. Everything in the media is lies.

Others are not the same as us, yet as young children we are essentially self-focused and see them as mirrors. They are not mirrors. It’s just the mirror neurons of the brain functioning to help us fit in and socialize our brain. What separates people socially are their VALUES which come from a conscience. Our families can only achieve so much in that area. The larger culture steps in affecting our own proclivities and we walk the line of loving others with healthy boundaries or using others with no boundaries.

That’s where SAFE behavior and observation and higher thinking comes in. Today it is seen as TONE 6 whose attributes are balancing equality with organization. There is little if any equal sharing of power on earth whether it be between genders or cultures (races is a misnomer). That’s because the levels of intelligence between humans has a HUGE DIVIDE. Most of the population can only organize their thoughts to the level of a fifth grader and the handful that are doing us in are evil geniuses. This is not a good combination and that is where we find ourselves today.

The Moon is in Gemini and Mercury is the mediating planet for White Dog∞Red Moon so as usual, that is an exact synchronicity with astrology.

Our theme today is White 6 Dog; Love, loyalty and heart. White dog is a strong leader, a guardian, a companion, consistent, faithful, a team player and a joiner. This is a nice change of pace and there are many people like this. It’s not necessarily safe for them to be on the street, but yes, they exist.

The Analog is Red 6 Moon; purification, flow and universal water. I blogged on Red Moon yesterday. Knowing how you feel helps you follow the road signs.

The Antipode is Yellow 6 Sun; enlighten, life, and Universal fire. This is a very spiritual archetype and White Dog is not terribly spiritual but more natural and simple. The Spiritual movement and habits can be challenging for them where in their Dog world, making a meal for someone they care for is as spiritual as they get.

The Hidden Wisdom is Blue 8 Monkey or Galactic play, illusion, and magic. This O.P. gives this kin great physical prowess to the point of being an athlete.  It is artistic with the body, spontaneous, extraordinary and a co-creator of higher physical life.

MOLECULAR LINE-UP

Methionine and the Stop Codon are the Start and Stop codon for the mRNA sequence. That is Yellow Sun and Blue Monkey

Knowing and Admitting Your Feelings About a Situation is Really Important


Welcome to another day in the matrix where synchronicity with All That Is are the road signs, as long as we’re paying attention. This blog is an attempt to free your VISION so that you glide easily between inner vision of yourself and your body and the outside world, or what we perceive as the outside world. I believe it’s actually ALL ONE Big Mind in the illusory hologram that we perceive with our five senses.

For thirty years I’ve witnessed and been personally involved in amazing, unmistakable synchronicity that can be explained no other way. So have countless others. But there is still this outside screaming chorus of CONTROL from the spiritually ignorant, greedy, bitter victims and psychopaths that would have us believe THEY are in control of the Matrix. Yeah, no. But in this local universe they are free to try up to a point. I can tell you that the E.T.’s helping us have time and again shut down our nukes and that will continue. They are not allowed to destroy the human race or the Earth. It’s in the contract.

The Matrix command and control is Galactic Center. We live in a Grand Universe that is organized according to Love and Light but because of free will, dissent, evil, violence, resistance and mischief are allowed to exist. There are 300 species of E.T. alone on THIS planet, underground, among us as humanoids, and in our local solar system. They are NOT a threat to us but we are EVER SO MUCH to them because of our unwillingness to control our drama and bodies. Humans need to get with the program and become CO-CREATORS instead of reacting like little children all the time. E.T.’s are just people. Hopefully soon all will be disclosed and the intelligence they’ve left us will come to the surface.

Knowing our Feelings is EMPOWERING!

Today is Red 5 Moon or Radiant Methionine which is the START CODON for the tRNA in all RNA sequences. It’s attributes are; purification, flow, and universal water. I talked extensively about water, hydrogen, and the tetrahedron yesterday without realizing that TODAY was the Water archetype. It’s analog is White 5 Dog which is Radiant Love. Red 5 Earth is the Guide Power, Blue 5 Storm is the Antipode and Yellow 9 Human is the Hidden Wisdom. The nutshell of that is, our bodies and feelings are bonded to Love and Loyalty. That truth is our accurate NAVIGATION in the matrix. Notice I didn’t say we ARE our feelings or that we should SIT IN our feelings. They are just road signs and then should be released. But don’t ignore the road signs in the Matrix or you’ll go off your rails. Our challenge and gift is to use that to catalyze SELF-GENERATION and INTERNAL ENERGY or QI. As Solar children, children of the Sun and the earth, our wisdom is to accept who we are in this incarnation. Follow the Sun cycles and the Earth cycles, not humans and their institutions. We have free will and real influence with other species. We are creators and holders of the chalice, the Holy Grail. We are vessels of a higher power and some would like to steal that from us. Hold your boundaries with the FOCUS of your mind. Navigate your body and mind. The Universe has your back. It’s not useful to offload your story or drama onto other people right now. Just align your daily behavior with your internal power. People can feel it. Act more, talk less.

MOLECULAR LINE-UP

  • Red 5 Moon is the theme; Methionine, the start codon
  • White 5 Dog is the analog; Aspartic Acid
  • Red 5 Earth is the Guide Power; Phenylalanine
  • Blue 5 Storm is the Antipode; Tryptophan and a type of Stop Codon
  • Yellow 9 Human is the Hidden Wisdom; Glutamic Acid

Just for fun, look at how similar the scientists depiction of a tRNA molecule looks to the Tzolkin Themeplex. Again, synchronicity. Just flip it to the right. The antipode/anti-codon is on the left.

Contains attachment site at the 3’ end for an amino acid. Contains a loop with the ___________. Fig ’ 5’ The anticodon base-pairs with a complementary codon on mRNA. If the codon on mRNA is UUU, a tRNA with a. ______ anticodon and a tRNA carrying phenylalanine will bind to it. The anticodons of some tRNAs recognize more than one________. Why? Because the rules for base pairing between the third base of the codon and anticodon are ________ (called______________).

Bring Light Into the Body to Survive the Mental Darkness of People Obeying Indolence


DRINK LOTS OF WATER-GOOD WATER!

The tetrahedron is the 4 sided geometrical shape we know as a pyramid. It has one unified point in the center and 5 vertices. Very synchronistically, a WATER molecule is a Tetrahedron. When you drink water you’re drinking microscopic pyramids. Every one of our amino acid proteins that make up every single cell of DNA in our bodies has hydrogen and the Tzolkin Harmonic regulates their movement as time which is DNA. It’s one of the main 5 molecules that compose all life. Hydrogen is the main ingredient in water. Hydrogen is literally called the WATER GENE. It’s the main gene that makes up our genes!

The Pyramid is a tetrahedron with 4 sides and 5 vertices

We know the origin of oxygen on the planet was the first algae that grew here but what is the origin of water? It is our ancient ancestors, the Life Carriers. They have the hydrogen gene and if the atmosphere is ready to grow hydrogen they bring it to the planet. Like most of our amino acids, they found hydrogen IN THE STARS. Stars are made of very hot gas. This gas is mostly hydrogen and helium, which are the two lightest elements. Stars shine by burning hydrogen into helium in their cores, and later in their lives create heavier elements.

TODAY IS Yellow 4 Star so it’s very synchronistic that I found this. From planet to planet, pyramids can be found in our local system. They seem to be structures that are a type of LAB to ground life force on a planet; life we all share. Maybe they are water labs. I haven’t read up on the pyramids yet but the Egyptians were partial to pyramids as well as the Maya and they were from our beloved Pleiadean star system which is closely aligned with VENUS, our mediating planet today.

The 5GForce is Yellow 10 Human which lends credence to the idea that bringing water to a planet from the hydrogen made from stars helps humans evolve.

“I perfect in order to influence. Producing wisdom I seal the process of free will with the planetary tone of manifestation. I am guided by the power of universal fire. I am a galactic activation portal. Enter me.“-The Dreamspell

The Planet Venus mediates Yellow Star and Blue Monkey; leucine and  asparagine.

https://www.resonancescience.org/blog/Tetrahedral-geometry-of-water-found-to-account-for-its-remarkable-properties?fbclid=IwAR2IMPinYan1YOFpFvzWtS72fnu7Y2HgvfvoWOjTN1so8EbU7ewMJF-FzJ0

MOLECULAR LINEUP

  • Theme is Yellow Star-Leucine
  • Analog is Blue Monkey-Asparagine
  • Guide Power is Yellow Seed-Valine
  • Antipode is White Mirror-Tyrosine
  • Hidden Wisdom is Red Skywalker-Glutamine

Blue 3 Hand Healing Energy with Mars conjunct Chiron We can Accomplish Some Cleansing


It is a time of RELEASE from repressed energies. Our mission is to heal OURSELVES. Sure, we can help others somewhat but in the end, each individual has to finish it off alone. Only you know how you really feel. But we are ready to address problem areas.

The Moon is in steady Taurus so there is an earthy, grounded feel to these movements. We like things that are familiar and reliable. The Moon also has an alignment to Uranus though which is in the Themeplex as the antipode, so while Uranus has some novel ideas or approach it could be challenging as well as a gift for those that are used to habits. Uranus shakes things up! (Aquarius).

(Note: Donald J. Trump is also Blue 3 Hand. While it is true that he is likely the most hated, maligned, mistrusted person on the planet right now he is also in charge of DISCLOSURE at the highest political levels on our planet of Luciferian pedophila, incest, child molestation, addiction to blood sacrifice on the part of the ELITE and a certain evil that has permeated our planet for maybe 1000 years in every country. His mission is not to be a good President, which in my opinion, he is not. He has a thick enough skin to withstand rooting out the most pernicious evil, the most entrenched evil via the Illuminati institutions of religion and state the world has ever seen. I’m not sure he can accomplish it. Everyone wants him destroyed. He is pulling up to the surface, the collective SUBCONSCIOUS MIND of family abuse of children that everyone is in denial about and no one wants to deal with. )

This is a good time to mention that your birth themeplex DOMINATES your day, every day despite the spiraling of the Tzolkin. Think of your birth themeplex as the sun and the Tzolkin daily themeplex as a planet in orbit around you.

The 5GForce today is Red 11 Skywalker; I dissolve in order to explore. Releasing wakefulness I seal the output of space with the spectral tone of liberation. I am guided by my own power doubled.

MOLECULAR LINEUP

Death. What Everyone Fears the Most These Days.


Today is White 2 Worldbridger which is the amino acid Threonine. Tone 2 balances and stabilizes by polarizing. Attributes are change, death, equalizing, opportunity, surrender, transmutation and grounded in spirit.

Our DNA is binary in it’s movement and is two strands. Stabilizing change is sort of what this planet is all about so we can evolve forward. We are going through that right now. The viruses are pure RNA and DNA. So are bacteria by the way. They are not our enemy or contamination. The DNA of most bacteria is contained in a single circular molecule, called the bacterial chromosome. The chromosome, along with several proteins and RNA molecules, forms an irregularly shaped structure called the nucleoid. … In addition to the chromosome, bacteria often contain plasmids – small circular DNA molecules. Bacteria and viruses are made of the same stuff we are but they are much more simple organisms. Nevertheless, they are ONE with us from the beginning and help us ADAPT to this planet.

Our greatest enemy is OURSELVES; clenching our minds in irrational fear and allowing ourselves to be programmed by outside forces; people and media because we are SO out of touch with our bodies and the earth. The real contamination are our HABITUAL, IRRATIONAL, negative thoughts, feelings, fears and letting other people be our Gods and we feel we have to obey. All of that is wrong and has contaminated the planet. It will kill us if we don’t turn it off and get meditating, exercising, and loving ourselves. Again, that’s what all of this is about. There is nothing communal and considerate about people obeying each other out of fear and then taking actions that will not have the desired outcome; something good.

I’ve also noticed that those who are introverts want and need to be out and about more and know we need to be in personal contact with people again and those that are extrovert, the majority of humanity, enjoy working at home now and not dealing with people at all. I’ve been doing that for 20 years so…yeah! I need to get out and I’m stopped at almost every door by a mask. Not doing it. I just have people to my house.

The tables are turning. The introverts who have an active mind, independent, take care of themselves and love being alone are going to LEAD. This is a stabilizing influence. The truth is, humans are ambivert; both enjoying the company of others sometimes and being alone.

The microbes purpose is to challenge our bodies to come into better alignments with universal energies. That doesn’t seem to be understood by the medical establishment but many people are having pineal gland activation with the Covid19 virus. I sure did. It changed me. The pineal gland is the third eye, right in the middle of the forehead, behind it in the deeper brain. It’s a literal gland and has to be activated now.

The pineal gland is fairly far back in the brain, straight behind the middle of the forehead. It is key for activation of the higher brain.

MOLECULAR LINEUP

Threonine and Glutamine both have polar uncharged side chains and histidine and arginine both have electrically charged POSITIVE side chains. All of them are hydrophillic water loving.

Tyrosine is a hydorphobic A.A. and doesn’t like water, or emotions. It is White Mirror and can sit there and look in the mirror and feel nothing. It’s just examining things. All in all it does balance out the themeplex. Until noon today we are under the strong influence of White 2 Mirror. The afternoon is always dominated by the antipode and today it will be Yellow 2 Warrior or stabilizing intelligence.

ASTROLOGY LINE-UP FROM CAFE ASTROLOGY. Parentheses are my comments.

  • The Moon continues to transit the sign of assertive, innovative Aries until 1:34 PM EDT when it enters Taurus, and a slower, more deliberate approach to the day is favored.
  • Emotions settle a little, but we can be inclined to overindulgence. (Tone 2)
  • The Sun and Jupiter (Blue Eagle) are heading into opposition, exact early tomorrow, and recent excesses can come to light, demanding a change or shuffling of priorities.
  • Conflicting urges regarding what we think we should do and what we want to do can be an issue. (Tone 2)
  • There are two areas of life where we have a particular need to shine, grow, and improve, represented by the Sun in Cancer and Jupiter in Capricorn, but these may seem to be in direct conflict with one another at this time. (TONE 2)
  • Culminations or unexpected changes in a project or ambition might occur, and this can be a time for reaping the rewards.
  • The urge to grow and expand is strong. If we’ve been overreaching, however, it may be time to adjust our expectations. (White Worldbridger)
  • Mars and Chiron are heading into alignment, and we may feel a sense of mission or gain increased courage to address problem areas in our lives, particularly related to self-confidence and independence. (Red Skywalker is mediated by Mars-THE ANALOG TODAY)
  • There is a drive to take decisive action, possibly defend or help others, or better ourselves. (Yellow 2 Warrior)
  • Physical healing can assist with inner healing and vice versa. (White 2 Mirror)
  • The void Moon occurs from 11:54 AM EDT, with the Moon’s last aspect before changing signs (a square to Saturn), until the Moon enters Taurus at 1:34 PM EDT.

Red 1 Magnetic Serpent is about Survival, Passion, and Instinct. New 13-Day Cycle.


There’s the asteroid belt not far from Earth. It used to be the planet Maldek/Tiamat. Mars was it’s moon. Obviously, the asteroid belt is 3D. It’s really there held in orbit by?… It’s own dreamspell which each planet has. In other words, it’s own electromagnetic signature, like a person’s fingerprint. It lends credence to validity of ASTROLOGY. Geez, look at how big Jupiter and Saturn are. We JUST brought them into check finally. They had us under the false timing frequency of 12:60 and believing the #7 was spiritual. No it’s not. 13:20 is the TOP DEAL.

Red 1 Magnetic Serpent starts us off today and Red 13 Earth will end up the cycle. So we go from honing our survival instincts to having Cosmic Synchronicity with which to navigate our NEW EARTH in the Aquarian Age. Aquarius is ruled by Uranus whose Time Tunnels are now open in the Cosmic Web. Keep an eye on your Red Earth-White Wind Kin. They are now getting unconscious downloads.

Meditation, emotional authenticity, passion, and intimacy will be powerful attractors and catalyzers over the next 13 days. In addition, MERCURY GOES DIRECT today. The Sun may be in Cancer but with Mars in Aries and the recent Jupiter-Saturn conjunction, nothing feels terribly homey. Today there is a square between Mars and Sun in Cancer as well. With Yellow 13 Warrior as the Hidden Wisdom we’ve got the highest level of mental discipline and intelligence possible and could actually get some good work done. That’s what I’m doing.

We also enter the Blue Western Castle (52 days) of Burning today. It’s the Court of Magic and it’s mission is to transform the stars. We enter IChing Hx 59 which is Dispersion and Dissolution as a 3D influence! There are 5, 52 day castles in a 260-day cycle. 5×52=260.

The 5G Force from the 5th Dimension is Blue 13 Eagle which was the ANALOG YESTERDAY! That is a big synchronicity. Cosmic Vision and authenticity with that is vibrating at warp speed.

MOLECULAR LINE-UP

Arginine and Lysine are the synchronous molecules with plenty of carbon again. Histidine and Phenylalanine look alike also. Vision, receptiveness, Intelligence and Navigation are in our DNA!!!

Serine is Red Serpent,

Lysine is White Wizard,

Aspirigine is Blue Eagle and

Histidine is Yellow Warrior.

The Artificial Covid19 Sequence Will Likely be Unsuitable For a Vaccine. By Dr. Fernando Castro Chavez.


Dr. Chavez is currently working with the 2008 Nobel Laureate Luc Montagnier, the founder of the HIV retrovirus, on fleshing out the true nature of the Covid19 signature and he’s my friend. In between his important work I’ll get his attention, which I already have somewhat since he is familiar with the Mayan system as well and we are on the same page as we talk. Much of his work has fueled my project and I’m very grateful. -Lisa T.

“To the current director of the NIH:

As a Postdoctoral student of Molecular Biology, my focus has been on analyzing the sequence of the current COVID-19. It is so alarming to find the artificiality within it, that I have written to NIH director Frances S. Collins, entitled “A Vital Letter On The Preservation Of Humanity As We Know It”:

Dr. Collins,

As I have had the blessed confidence to write to a brother in Christ since day one, I am sending you this important message. With my best regards,
Fernando Castro-Chavez, PhD.

P.S:
I could not fit this vital link into the letter that independently exposes the hoax imposed on humanity 19 years ago. Let us do all we can to prevent this from happening again but on a wider scale.

AT LEAST SIX RESEARCH GROUPS HAVE FOUND HIV INSERTS IN SARS-CoV-2

Sir,

Prompted by this article: Jun 25, 2020 – Health: The NIH claims joint ownership of Moderna’s coronavirus vaccine: https://www.axios.com/moderna-nih-coronavirus-vaccine-ownership-agreements-22051c42-2dee-4b19-938d-099afd71f6a0.html (https://archive.vn/TArE3), I write to you, saying that we had a deep respect for you (my sister, my girl companion and my peers). The first letter I wrote to you was about Creation, in 2000, just having arrived from my country, written in bad English at least I was willing to live the American dream!!!

Then, we saw you in person and introduced ourselves. You went to the BMC to give a speech about The Human Genome Project, I remember that you said something like: “Mendel is also there, in this slide, right there at the corner…”; then I wrote about our dreams to pursue, not only this Postdoctoral couple of jobs in Medicine but also an MD Career. We two are starting again from scratch. Dreaming to be truthful and to really help humanity… However, now, I dedicate myself to you my current findings, humble, but nonetheless, they are still findings:

1) “COVID-19: AATGGTACTAAGAGG (NGTKR) = HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene (GU455503)”. Finding also done by:

2) Shi Zheng-Li, from the WIV at Wuhan and co-author of Ralph Baric. She distinctively calls it an “INSERTION” (she puts it as GTNGTKR, GGGACCAATGGTACTAAGAGG, adding other two more, but skipping the key one: The Furin Site!), whose putative function is immunosuppressant, as she says that those INSERTIONS have: “sialic-acid-binding activity”, at Zhou, P., plus 27 et al & Zheng-Li Shi.A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020:579:270-73, & 16pp: https://www.nature.com/articles/s41586-020-2012-7.pdf; a third group that found these unique INSERTS is that of:

3) Sørensen (identical to the previous one: GTNGTKR, but also studying, to leave no doubts, its functional span by performing 6 by 6 NT iterations containing our sequence of interest (and of many others), such as VSGTNG, SGTNGT, TNGTKR, NGTKRF, etc.), who says in an interview, as he found many more INSERTS (saved at https://archive.vn/7TPTc): “The INSERTED sequences have a functionality that we describe.

We explain why they are essential: …accumulated charge from inserts and salt bridges are in surface positions capable of binding with cell membrane components other than the ACE2 receptor.” This statement is very important and indicates that if we realize that this virus is NOT natural we could be and could have been better prepared since the start to fight against it in a more logical, rational, and prepared way, which did not happen. The artificiality of the virus also makes it unsuitable for vaccination, instead of the opposite, because that is the way the human tampering of nature works. The attempted purpose of its design is to do one thing, and it happens to result in just the opposite thing than what was wanted: “…the naked coronavirus spike protein as a concept for the basis of a vaccine, which we have rejected because of a high risk of contamination with human-like epitopes.

Analysis of the Spike protein of SARS-CoV-2 shows 78.4% similarity with human-like (HL) epitopes…” and “… A search so tailored to match against all human known proteins will give a 78.4% human similarity to the SARS-CoV-2 Spike protein, i.e. if all epitopes on the 1255 amino acid long SARS-CoV-2 Spike protein can be used by antibodies then there will be 983 antibody binding sites which also could bind to epitopes on human proteins…”The original article delving into all of those technicians is: Sørensen, B., Susrud, A. and Dalgleish, A.G. Biovacc-19: A Candidate Vaccine for Covid-19 (SARS-CoV-2) Developed from Analysis of its General Method of Action for Infectivity. QRB Discovery (by Cambridge University Press) 2020:17 pp [Accepted Manuscript]: https://doi.org/10.1017/qrd.2020.8.

This important article clearly indicates that if we do NOT realize the real origin and the real nature of this virus, we will continue to be deceived as per its treatment and its strategies of attack, and will be responsible for having on purpose dimmed the light of its artificial origin. Especially when we all are aware that the authors of “The Proximal…”, Andersen et al. Nat. Med. 2020 article have been written by reefers that have ever been used for political purposes rather than scientific ones.

So, apart from as these three independent findings of that and many more related HIV sequences, we have another two sets of witnesses, totaling FIVE independent groups finding this: Mine, Zheng-Li’s, and Sørensen’s, but also:

4) Pradhan, from the Indian group that was forced to withdraw its article, who calls the contained sequence under consideration as the previous ones: “INSERT 1″: TNGTKR, elongating the set of meaningful nucleotides as TCTGGGACCAATGGTACTAAGAGG (SGTNGTKR): Pradhan, P. et al. Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag. Biorxiv 2020: 14 pp. (Withdrawn, 128 comments): https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1, they start describing their findings as follows:”We found four new insertions in the protein of 2019-nCoV- “GTNGTKR” (IS1)…”, but this is not all, but also a fifth group, being this the one integrated by:5) Perez and Montagnier (2008 Nobel Prize in Medicine, precisely for his discovery of the HIV virus), and they describe our found sequence within, together with a couple of tens more: TCT GGG ACC AAT GGT ACT AAG AGG TTT GAT AAC CCT G (SGTNGTKRFDNP…, finding them in here, fragments of SIV joined to the HIV-1A that I found, and sown in point “1”), from these sequences found by them, they start and end their meaningful conclusions, coming from the wisest of men, as follows:1) 18 RNA fragments of homology equal or more than 80% with human or simian retroviruses have been found in the COVID_19 genome;

2) These fragments are 18 to 30 nucleotides long and therefore have the potential to modify the gene expression of Covid19. We have named them external Informative Elements or EIE;

3) These EIE are not dispersed randomly, but are concentrated in a small part of the COVID_19 genome… …everything converges towards possible laboratory manipulations which contributed to modifications of the genome of COVID_19, but also, very probably much older SARS, with perhaps this double objective of vaccine design and of “gain of function” in terms of penetration of this virus into the cell. This analysis, made in silico, is dedicated to the real authors of Coronavirus COVID_19. It belongs only to them to describe their own experiments and why it turned into a world disaster: 400 000 lives, more than those taken by the two atomic bombs of Hiroshima and Nagasaki.

We, the survivors, should take lessons from this serious alert for the future of humanity. We urge our colleagues’ scientists and medical doctors to respect ethical rules as expressed by Hippocrates oath: do no harm, never and never!”; an earlier manuscript of them can be found at Perez, J.-C., and Montagnier, L. COVID-19, SARS and Bats Coronaviruses Genomes Unexpected Exogenous RNA Sequences. ResearchGate & OSF 2020:43 pp. [Older Manuscript]: https://osf.io/d9e5g/download/?format=pdf.

I started my letter saying that I used to have respect for you. However, the standing taken as to ignore the real origins documented by these five research groups and by countless others, of the whole pre-planning of the current Pandemic by COVID-19, has made me change my current opinion about you.

6)Arumugham also discusses such “Artificial selection at work… via recombination with HIV-1 derived inserts and selecting the viruses for efficient human kidney cell infection”, and my comment is again that to notice this artificial origin of COVID-19 is very important to do the proper treatment to patients, and to prevent another thing like this from emerging out of a Gain of Function “research”: Arumugham, V. Root cause of COVID-19? Biotechnology’s dirty secret: Contamination.Bioinformatics evidence demonstrates that SARS-CoV-2 was created in a laboratory, unlikely to be a bioweapon but most likely a result of sloppy experiments. Zenodo 2020:9 pp. (Manuscript saved at: https://archive.vn/N79Ci): https://zenodo.org/record/3766463#.Xuu9RTpKjIW

My experience on finding human artifacts on genomes dates back to the EcoRI palindromic linker that is contaminating thousands of sequences in the Genbank: Castro-Chavez, F. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes. DNA Cell Biol. 2012, 31(2):151-63: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3272245/

The freedoms of the whole humanity are at stake and the good God The Creator that you deeply respect, has put you in a key position as to be able to revert as soon as possible the current decline of the human values, and of the human nature in general, and this all because of a deliberate release of the current Sars-CoV-2. 9/11. It was the first False Flag Operation aimed at stealing as many freedoms as possible from the human race, and the Fake Anthrax Attack of 2001 had the same purpose, releasing a pre-planned and the very anti-patriotic document called the “Patriot” Act, which also included an immunity clause preventing the Pharmaceutical Industry of even more liabilities, but it was contested by the population, and it was removed. So, I wish to stop the GoF initiatives.

Here we are today, contesting the “official” narrative of the current Plandemic as we did in the past with the “official” narratives of 9/11 when we discovered nano-bombs and fake planes injected into the TV screens. I expect to publish this letter out in the open after you have read it. Only history will tell if TRUTH was able to win on this time over darkness, or if the criminals will get away once more… With my same thinking as at the beginning of the current letter (but praying that this could very soon change),

Fernando Castro-Chavez, PhD.

P. S.

My ongoing work can be found at the ResearchGate. While many pieces of it have been removed from Facebook and from the YouTube by some heartless and brainless censors appointed by the WHO and by their owner, Bill Gates, apparently the mastermind, chosen by the globalists to pull this event of an artificially manufactured viral harm for the whole of humanity, it is there. But as Mordechai told to Esther: “If you do nothing about it, God will raise somebody else to redeem us of this plague, because our clamors for freedom and for justice have already reached the Heavens”. Jesus said that it will not be so easy for the believers to overcome evil in the current times, but that it could be possible. As Christian believers, we believe that as long as we continue over the earth, the total fruition of the plans of darkness can NOT prosper, and you may be a key member of the Body of Christ in order to fulfill such restraining against the forces of evil of this world. Thus far, the next are some of the sequences that seem to be inserted (some of them seem to have been started to be tampered with since the RaTG13 “experiment” of Shi Zheng-Li, a genome she had since 2013 but that she did not publish until 2020 after the first Sars-CoV-2 had been published in China, a genome that of the RaTG13 (previously published in part twice with different names that included the number 4991.

That is dishonesty in science to change the names of the sequences, and that is what Shi just did!). It has been used, ironically, even with all its methodological anomalies, to precisely attempt to undermine the artificiality of the inserts. Even two sequences published earlier by the Chinese Military seem to have been already tampered with to make them more infectious. This is what happens when you only have the sequences provided by them with nobody else corroborating their authenticity), so, I may use the “probable” inserts clause, mostly from HIV-1, some few from HIV-2 and one from SIV (as explained by Perez & Montagnier, 2020).

So, the number of artificial sequences is growing as research progresses, that is why, when people try to discredit some of these from being artificially made, the burden is over them to explain how all of them got INSERTED into one same viral genome, which may have required the same animal cell with multiple different viruses and even bacteria exchanging only the specific required portions and no more, which is something naturally implausible but completely possible within a lab setting. (then I add here the list from my previous posting in response to Jennifer Clarkson, adding that there, (most of those sequences are concatenated sequences).”I have also added here my last comparison of the sequences found in Nsp3 by A. V., highly specific both to COVID-19 and to HIV-1.

*The link by hero Robert F. Kennedy Jr. denouncing the big conflict of interests in which the NIH is involved: https://www.instagram.com/p/CCAcwVkHCec

*And this Fourth of July, I present here some of the current sounds of my dear nation: https://archive.vn/THJ2h, https://ourrescue.org/, https://qmap.pub/ (saved at, as per today: https://archive.vn/Us7O8)…”

: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031— with Karen Wierwille Martin.

We’re Done With This 13-Day Cycle, and the British Parliament, and The Cabal, and The Vatican.


In addition, the heatwave has broken. The story of the Dreamspell calls the institutions in the Matrix (12:60), the Time Thieves. They steal time and make it money instead of letting it be what it truly is; OUR BODIES, OUR DNA, OUR CONSCIOUSNESS. The motto in the matrix is “Time is Money”. The motto in true time is “Time is Art” or whatever you want it to be. It’s a dramatic title for effect and is, in effect, what these institutions did to our planet and our species for the last 5200 years, maybe more. It depends on your view of history.

Humans haven’t always been on this planet, in fact, we just got here only a million years ago and have been evolving nicely since. But we have been SORELY hampered by a time theft, theft of planetary power, and freedom for the kin of earth to live according to the universal harmonics of 13:20. Instead, we were sold a bill of goods; the 12:60, power of 7, power of 5 FAKE TIME that is IN NO WAY aligned with the natural movements of the solar system and the galaxies, our bodies and the crystal core of the planet We were cut off from the universal circuits because of the dissonance.

That is over now. Our matrix is free to move forward in any way we wish. We just have to let go of the past now and let our brains be re-programmed to the natural timing frequency. That’s the purpose of the Tzolkin harmonic or the Mayan Calendar.

We end the Yellow Human 13-day cycle with Yellow 13 Seed TODAY.

Humans have become COSMIC seeds finally, aware of Source, hooked to Spirit, meditating, and cleaning up our bodies and our earth. Our 5G fifth-dimensional mantra for today is;

“I unify in order to question. Attracting fearlessness I seal the output of intelligence with the magnetic tone of purpose. I am guided by my own power doubled.”

Kin 196, Yellow 1 Warrior, The Dreamspell by Jose A.

Tone 13 governs the day. Its attributes are Transcending, Presence, and Endurance. Cosmics have the patience of a great tree. Psychically, they have been through most of what you experience around you. Cosmics of all the archetypes are usually lightworkers, leaders, and teachers. You would be wise to listen and learn. If you find one in shadow, no doubt they have caused themselves a load of suffering from some type of stubbornness that only they can release.

With this change of status in the Matrix, any mental distortions or mental illness of Red Earth∞White Wind (mediated by Uranus) and Blue Hand∞Yellow Human KIN (mediated by Earth) should change their brains significantly. They can now get direct transmissions from their HOME PLANETS (Uranus and Earth) with the cosmic web aligned. The time tunnels make up the cosmic web and our U.S. military is fully aware of them. There is even a map.

Also with this change, our Yellow Seed∞Blue Eagle (mediated by Jupiter) and Blue Night∞Yellow Warrior kin (mediated by Saturn) should be quite a bit clearer on the ROLE OF POLITICS and RELIGION, where it begins and where it ends, especially on earth. In no way does it DEFINE THE PERSON’S SOUL OR CHARACTER on this planet. Nada!

This kin doesn’t yet fully understand the power of heart, emotion, and love and acceptance in diversity in spirituality unless they are more advanced and have gone through some earth discipline. Still, there may be some ego and sense of being gypped by humans. In addition, they are proponents of the family and ancestry due to the forms on Saturn. That has it’s limit too and has held GAIA in the 12:60 matrix of THE PAST. Be patient with this kin as they will no longer be receiving the distorted 12:60 transmissions from Jupiter and Saturn.

MOLECULAR LINE-UP

  1. Yellow Seed is VALINE
  2. Blue Eagle is Arginine
  3. Yellow Star is Leucine
  4. White Wizard is Lysine
  5. Red Earth is Phenylalanine

There are CARBON molecules all over the place in this themeplex. That indicates a large EARTH SETTLING role in evolution. Carbon is not in most of the amino acids.