Red 1 Magnetic Serpent is about Survival, Passion, and Instinct. New 13-Day Cycle.


There’s the asteroid belt not far from Earth. It used to be the planet Maldek/Tiamat. Mars was it’s moon. Obviously, the asteroid belt is 3D. It’s really there held in orbit by?… It’s own dreamspell which each planet has. In other words, it’s own electromagnetic signature, like a person’s fingerprint. It lends credence to validity of ASTROLOGY. Geez, look at how big Jupiter and Saturn are. We JUST brought them into check finally. They had us under the false timing frequency of 12:60 and believing the #7 was spiritual. No it’s not. 13:20 is the TOP DEAL.

Red 1 Magnetic Serpent starts us off today and Red 13 Earth will end up the cycle. So we go from honing our survival instincts to having Cosmic Synchronicity with which to navigate our NEW EARTH in the Aquarian Age. Aquarius is ruled by Uranus whose Time Tunnels are now open in the Cosmic Web. Keep an eye on your Red Earth-White Wind Kin. They are now getting unconscious downloads.

Meditation, emotional authenticity, passion, and intimacy will be powerful attractors and catalyzers over the next 13 days. In addition, MERCURY GOES DIRECT today. The Sun may be in Cancer but with Mars in Aries and the recent Jupiter-Saturn conjunction, nothing feels terribly homey. Today there is a square between Mars and Sun in Cancer as well. With Yellow 13 Warrior as the Hidden Wisdom we’ve got the highest level of mental discipline and intelligence possible and could actually get some good work done. That’s what I’m doing.

We also enter the Blue Western Castle (52 days) of Burning today. It’s the Court of Magic and it’s mission is to transform the stars. We enter IChing Hx 59 which is Dispersion and Dissolution as a 3D influence! There are 5, 52 day castles in a 260-day cycle. 5×52=260.

The 5G Force from the 5th Dimension is Blue 13 Eagle which was the ANALOG YESTERDAY! That is a big synchronicity. Cosmic Vision and authenticity with that is vibrating at warp speed.

MOLECULAR LINE-UP

Arginine and Lysine are the synchronous molecules with plenty of carbon again. Histidine and Phenylalanine look alike also. Vision, receptiveness, Intelligence and Navigation are in our DNA!!!

Serine is Red Serpent,

Lysine is White Wizard,

Aspirigine is Blue Eagle and

Histidine is Yellow Warrior.

The Artificial Covid19 Sequence Will Likely be Unsuitable For a Vaccine. By Dr. Fernando Castro Chavez.


Dr. Chavez is currently working with the 2008 Nobel Laureate Luc Montagnier, the founder of the HIV retrovirus, on fleshing out the true nature of the Covid19 signature and he’s my friend. In between his important work I’ll get his attention, which I already have somewhat since he is familiar with the Mayan system as well and we are on the same page as we talk. Much of his work has fueled my project and I’m very grateful. -Lisa T.

“To the current director of the NIH:

As a Postdoctoral student of Molecular Biology, my focus has been on analyzing the sequence of the current COVID-19. It is so alarming to find the artificiality within it, that I have written to NIH director Frances S. Collins, entitled “A Vital Letter On The Preservation Of Humanity As We Know It”:

Dr. Collins,

As I have had the blessed confidence to write to a brother in Christ since day one, I am sending you this important message. With my best regards,
Fernando Castro-Chavez, PhD.

P.S:
I could not fit this vital link into the letter that independently exposes the hoax imposed on humanity 19 years ago. Let us do all we can to prevent this from happening again but on a wider scale.

AT LEAST SIX RESEARCH GROUPS HAVE FOUND HIV INSERTS IN SARS-CoV-2

Sir,

Prompted by this article: Jun 25, 2020 – Health: The NIH claims joint ownership of Moderna’s coronavirus vaccine: https://www.axios.com/moderna-nih-coronavirus-vaccine-ownership-agreements-22051c42-2dee-4b19-938d-099afd71f6a0.html (https://archive.vn/TArE3), I write to you, saying that we had a deep respect for you (my sister, my girl companion and my peers). The first letter I wrote to you was about Creation, in 2000, just having arrived from my country, written in bad English at least I was willing to live the American dream!!!

Then, we saw you in person and introduced ourselves. You went to the BMC to give a speech about The Human Genome Project, I remember that you said something like: “Mendel is also there, in this slide, right there at the corner…”; then I wrote about our dreams to pursue, not only this Postdoctoral couple of jobs in Medicine but also an MD Career. We two are starting again from scratch. Dreaming to be truthful and to really help humanity… However, now, I dedicate myself to you my current findings, humble, but nonetheless, they are still findings:

1) “COVID-19: AATGGTACTAAGAGG (NGTKR) = HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene (GU455503)”. Finding also done by:

2) Shi Zheng-Li, from the WIV at Wuhan and co-author of Ralph Baric. She distinctively calls it an “INSERTION” (she puts it as GTNGTKR, GGGACCAATGGTACTAAGAGG, adding other two more, but skipping the key one: The Furin Site!), whose putative function is immunosuppressant, as she says that those INSERTIONS have: “sialic-acid-binding activity”, at Zhou, P., plus 27 et al & Zheng-Li Shi.A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020:579:270-73, & 16pp: https://www.nature.com/articles/s41586-020-2012-7.pdf; a third group that found these unique INSERTS is that of:

3) Sørensen (identical to the previous one: GTNGTKR, but also studying, to leave no doubts, its functional span by performing 6 by 6 NT iterations containing our sequence of interest (and of many others), such as VSGTNG, SGTNGT, TNGTKR, NGTKRF, etc.), who says in an interview, as he found many more INSERTS (saved at https://archive.vn/7TPTc): “The INSERTED sequences have a functionality that we describe.

We explain why they are essential: …accumulated charge from inserts and salt bridges are in surface positions capable of binding with cell membrane components other than the ACE2 receptor.” This statement is very important and indicates that if we realize that this virus is NOT natural we could be and could have been better prepared since the start to fight against it in a more logical, rational, and prepared way, which did not happen. The artificiality of the virus also makes it unsuitable for vaccination, instead of the opposite, because that is the way the human tampering of nature works. The attempted purpose of its design is to do one thing, and it happens to result in just the opposite thing than what was wanted: “…the naked coronavirus spike protein as a concept for the basis of a vaccine, which we have rejected because of a high risk of contamination with human-like epitopes.

Analysis of the Spike protein of SARS-CoV-2 shows 78.4% similarity with human-like (HL) epitopes…” and “… A search so tailored to match against all human known proteins will give a 78.4% human similarity to the SARS-CoV-2 Spike protein, i.e. if all epitopes on the 1255 amino acid long SARS-CoV-2 Spike protein can be used by antibodies then there will be 983 antibody binding sites which also could bind to epitopes on human proteins…”The original article delving into all of those technicians is: Sørensen, B., Susrud, A. and Dalgleish, A.G. Biovacc-19: A Candidate Vaccine for Covid-19 (SARS-CoV-2) Developed from Analysis of its General Method of Action for Infectivity. QRB Discovery (by Cambridge University Press) 2020:17 pp [Accepted Manuscript]: https://doi.org/10.1017/qrd.2020.8.

This important article clearly indicates that if we do NOT realize the real origin and the real nature of this virus, we will continue to be deceived as per its treatment and its strategies of attack, and will be responsible for having on purpose dimmed the light of its artificial origin. Especially when we all are aware that the authors of “The Proximal…”, Andersen et al. Nat. Med. 2020 article have been written by reefers that have ever been used for political purposes rather than scientific ones.

So, apart from as these three independent findings of that and many more related HIV sequences, we have another two sets of witnesses, totaling FIVE independent groups finding this: Mine, Zheng-Li’s, and Sørensen’s, but also:

4) Pradhan, from the Indian group that was forced to withdraw its article, who calls the contained sequence under consideration as the previous ones: “INSERT 1″: TNGTKR, elongating the set of meaningful nucleotides as TCTGGGACCAATGGTACTAAGAGG (SGTNGTKR): Pradhan, P. et al. Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag. Biorxiv 2020: 14 pp. (Withdrawn, 128 comments): https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1, they start describing their findings as follows:”We found four new insertions in the protein of 2019-nCoV- “GTNGTKR” (IS1)…”, but this is not all, but also a fifth group, being this the one integrated by:5) Perez and Montagnier (2008 Nobel Prize in Medicine, precisely for his discovery of the HIV virus), and they describe our found sequence within, together with a couple of tens more: TCT GGG ACC AAT GGT ACT AAG AGG TTT GAT AAC CCT G (SGTNGTKRFDNP…, finding them in here, fragments of SIV joined to the HIV-1A that I found, and sown in point “1”), from these sequences found by them, they start and end their meaningful conclusions, coming from the wisest of men, as follows:1) 18 RNA fragments of homology equal or more than 80% with human or simian retroviruses have been found in the COVID_19 genome;

2) These fragments are 18 to 30 nucleotides long and therefore have the potential to modify the gene expression of Covid19. We have named them external Informative Elements or EIE;

3) These EIE are not dispersed randomly, but are concentrated in a small part of the COVID_19 genome… …everything converges towards possible laboratory manipulations which contributed to modifications of the genome of COVID_19, but also, very probably much older SARS, with perhaps this double objective of vaccine design and of “gain of function” in terms of penetration of this virus into the cell. This analysis, made in silico, is dedicated to the real authors of Coronavirus COVID_19. It belongs only to them to describe their own experiments and why it turned into a world disaster: 400 000 lives, more than those taken by the two atomic bombs of Hiroshima and Nagasaki.

We, the survivors, should take lessons from this serious alert for the future of humanity. We urge our colleagues’ scientists and medical doctors to respect ethical rules as expressed by Hippocrates oath: do no harm, never and never!”; an earlier manuscript of them can be found at Perez, J.-C., and Montagnier, L. COVID-19, SARS and Bats Coronaviruses Genomes Unexpected Exogenous RNA Sequences. ResearchGate & OSF 2020:43 pp. [Older Manuscript]: https://osf.io/d9e5g/download/?format=pdf.

I started my letter saying that I used to have respect for you. However, the standing taken as to ignore the real origins documented by these five research groups and by countless others, of the whole pre-planning of the current Pandemic by COVID-19, has made me change my current opinion about you.

6)Arumugham also discusses such “Artificial selection at work… via recombination with HIV-1 derived inserts and selecting the viruses for efficient human kidney cell infection”, and my comment is again that to notice this artificial origin of COVID-19 is very important to do the proper treatment to patients, and to prevent another thing like this from emerging out of a Gain of Function “research”: Arumugham, V. Root cause of COVID-19? Biotechnology’s dirty secret: Contamination.Bioinformatics evidence demonstrates that SARS-CoV-2 was created in a laboratory, unlikely to be a bioweapon but most likely a result of sloppy experiments. Zenodo 2020:9 pp. (Manuscript saved at: https://archive.vn/N79Ci): https://zenodo.org/record/3766463#.Xuu9RTpKjIW

My experience on finding human artifacts on genomes dates back to the EcoRI palindromic linker that is contaminating thousands of sequences in the Genbank: Castro-Chavez, F. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes. DNA Cell Biol. 2012, 31(2):151-63: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3272245/

The freedoms of the whole humanity are at stake and the good God The Creator that you deeply respect, has put you in a key position as to be able to revert as soon as possible the current decline of the human values, and of the human nature in general, and this all because of a deliberate release of the current Sars-CoV-2. 9/11. It was the first False Flag Operation aimed at stealing as many freedoms as possible from the human race, and the Fake Anthrax Attack of 2001 had the same purpose, releasing a pre-planned and the very anti-patriotic document called the “Patriot” Act, which also included an immunity clause preventing the Pharmaceutical Industry of even more liabilities, but it was contested by the population, and it was removed. So, I wish to stop the GoF initiatives.

Here we are today, contesting the “official” narrative of the current Plandemic as we did in the past with the “official” narratives of 9/11 when we discovered nano-bombs and fake planes injected into the TV screens. I expect to publish this letter out in the open after you have read it. Only history will tell if TRUTH was able to win on this time over darkness, or if the criminals will get away once more… With my same thinking as at the beginning of the current letter (but praying that this could very soon change),

Fernando Castro-Chavez, PhD.

P. S.

My ongoing work can be found at the ResearchGate. While many pieces of it have been removed from Facebook and from the YouTube by some heartless and brainless censors appointed by the WHO and by their owner, Bill Gates, apparently the mastermind, chosen by the globalists to pull this event of an artificially manufactured viral harm for the whole of humanity, it is there. But as Mordechai told to Esther: “If you do nothing about it, God will raise somebody else to redeem us of this plague, because our clamors for freedom and for justice have already reached the Heavens”. Jesus said that it will not be so easy for the believers to overcome evil in the current times, but that it could be possible. As Christian believers, we believe that as long as we continue over the earth, the total fruition of the plans of darkness can NOT prosper, and you may be a key member of the Body of Christ in order to fulfill such restraining against the forces of evil of this world. Thus far, the next are some of the sequences that seem to be inserted (some of them seem to have been started to be tampered with since the RaTG13 “experiment” of Shi Zheng-Li, a genome she had since 2013 but that she did not publish until 2020 after the first Sars-CoV-2 had been published in China, a genome that of the RaTG13 (previously published in part twice with different names that included the number 4991.

That is dishonesty in science to change the names of the sequences, and that is what Shi just did!). It has been used, ironically, even with all its methodological anomalies, to precisely attempt to undermine the artificiality of the inserts. Even two sequences published earlier by the Chinese Military seem to have been already tampered with to make them more infectious. This is what happens when you only have the sequences provided by them with nobody else corroborating their authenticity), so, I may use the “probable” inserts clause, mostly from HIV-1, some few from HIV-2 and one from SIV (as explained by Perez & Montagnier, 2020).

So, the number of artificial sequences is growing as research progresses, that is why, when people try to discredit some of these from being artificially made, the burden is over them to explain how all of them got INSERTED into one same viral genome, which may have required the same animal cell with multiple different viruses and even bacteria exchanging only the specific required portions and no more, which is something naturally implausible but completely possible within a lab setting. (then I add here the list from my previous posting in response to Jennifer Clarkson, adding that there, (most of those sequences are concatenated sequences).”I have also added here my last comparison of the sequences found in Nsp3 by A. V., highly specific both to COVID-19 and to HIV-1.

*The link by hero Robert F. Kennedy Jr. denouncing the big conflict of interests in which the NIH is involved: https://www.instagram.com/p/CCAcwVkHCec

*And this Fourth of July, I present here some of the current sounds of my dear nation: https://archive.vn/THJ2h, https://ourrescue.org/, https://qmap.pub/ (saved at, as per today: https://archive.vn/Us7O8)…”

: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031— with Karen Wierwille Martin.

We’re Done With This 13-Day Cycle, and the British Parliament, and The Cabal, and The Vatican.


In addition, the heatwave has broken. The story of the Dreamspell calls the institutions in the Matrix (12:60), the Time Thieves. They steal time and make it money instead of letting it be what it truly is; OUR BODIES, OUR DNA, OUR CONSCIOUSNESS. The motto in the matrix is “Time is Money”. The motto in true time is “Time is Art” or whatever you want it to be. It’s a dramatic title for effect and is, in effect, what these institutions did to our planet and our species for the last 5200 years, maybe more. It depends on your view of history.

Humans haven’t always been on this planet, in fact, we just got here only a million years ago and have been evolving nicely since. But we have been SORELY hampered by a time theft, theft of planetary power, and freedom for the kin of earth to live according to the universal harmonics of 13:20. Instead, we were sold a bill of goods; the 12:60, power of 7, power of 5 FAKE TIME that is IN NO WAY aligned with the natural movements of the solar system and the galaxies, our bodies and the crystal core of the planet We were cut off from the universal circuits because of the dissonance.

That is over now. Our matrix is free to move forward in any way we wish. We just have to let go of the past now and let our brains be re-programmed to the natural timing frequency. That’s the purpose of the Tzolkin harmonic or the Mayan Calendar.

We end the Yellow Human 13-day cycle with Yellow 13 Seed TODAY.

Humans have become COSMIC seeds finally, aware of Source, hooked to Spirit, meditating, and cleaning up our bodies and our earth. Our 5G fifth-dimensional mantra for today is;

“I unify in order to question. Attracting fearlessness I seal the output of intelligence with the magnetic tone of purpose. I am guided by my own power doubled.”

Kin 196, Yellow 1 Warrior, The Dreamspell by Jose A.

Tone 13 governs the day. Its attributes are Transcending, Presence, and Endurance. Cosmics have the patience of a great tree. Psychically, they have been through most of what you experience around you. Cosmics of all the archetypes are usually lightworkers, leaders, and teachers. You would be wise to listen and learn. If you find one in shadow, no doubt they have caused themselves a load of suffering from some type of stubbornness that only they can release.

With this change of status in the Matrix, any mental distortions or mental illness of Red Earth∞White Wind (mediated by Uranus) and Blue Hand∞Yellow Human KIN (mediated by Earth) should change their brains significantly. They can now get direct transmissions from their HOME PLANETS (Uranus and Earth) with the cosmic web aligned. The time tunnels make up the cosmic web and our U.S. military is fully aware of them. There is even a map.

Also with this change, our Yellow Seed∞Blue Eagle (mediated by Jupiter) and Blue Night∞Yellow Warrior kin (mediated by Saturn) should be quite a bit clearer on the ROLE OF POLITICS and RELIGION, where it begins and where it ends, especially on earth. In no way does it DEFINE THE PERSON’S SOUL OR CHARACTER on this planet. Nada!

This kin doesn’t yet fully understand the power of heart, emotion, and love and acceptance in diversity in spirituality unless they are more advanced and have gone through some earth discipline. Still, there may be some ego and sense of being gypped by humans. In addition, they are proponents of the family and ancestry due to the forms on Saturn. That has it’s limit too and has held GAIA in the 12:60 matrix of THE PAST. Be patient with this kin as they will no longer be receiving the distorted 12:60 transmissions from Jupiter and Saturn.

MOLECULAR LINE-UP

  1. Yellow Seed is VALINE
  2. Blue Eagle is Arginine
  3. Yellow Star is Leucine
  4. White Wizard is Lysine
  5. Red Earth is Phenylalanine

There are CARBON molecules all over the place in this themeplex. That indicates a large EARTH SETTLING role in evolution. Carbon is not in most of the amino acids.

There are Limitations on an Evolutionary Planet


The reason there are limitations is because of TIME regulating movement. Time is just the movement of our planet/planets around our star, The Sun. Time is not REAL in the literal sense but it is real in our 3D, 5 senses perceptual sense. Our minds are hypnotized with the reality of Time just like the mask wearers are hypnotized by the specter of certain death whether it be from CV2, a hospital respirator, a botched hospital procedure that they submit to or their violent mate. None of that is real in that it doesn’t exist unless the mind of the person CREATES it by obsessively focusing on it all the time as well as the T.V. PROGRAMMING of their minds that they can’t turn off because they’re afraid they’ll miss something, like a message from ON HIGH since whatever is said on TV is altruistic, all-loving God looking out for them. They have to believe that because they are bereft and empty without it. So, I give up helping.

We are on Tone 11 White 11 Wind today and a majority of Americans are still spectrally, chaotically, dissolving themselves in fear, in a puddle, anywhere they find themselves. They are doing it to themselves in their limitation, in their fear, in their unwillingness to think rationally or spiritually. Some however, are waking up. That said, the authorities are tying the hands of business and sending out checks so there is something MUCH bigger going on.

I have a new theory about the people freaking out over a virus and believing they have NO IMMUNE SYSTEM WHATSOEVER to kill a virus even though the facts of the last ONE MILLION years of human existence prove otherwise. They can’t listen. Why not?

I dissolve in order to communicate. Releasing breath I seal the input of spirit with the spectral tone of liberation. I am guided by my own power doubled

The Dreamspell by Jose A.

Because they don’t really believe GOD or SOURCE is IN them. They think it’s a load of B.S. They are cynical 3D materialists who only feel what they can see, touch, hear, feel, and smell. That’s all that’s real to them and they don’t mind a mountain of evidence proving them 100% wrong because they don’t want to do the work to LISTEN and hook up to Spiritual presence in them through mediation and movement. They are scared of that too because they feel guilty for being weak and selfish.

My ex used to always say, “If you make a mistake you are forgiven.” That is true. But if you don’t learn to work at helping yourself you’re doomed. People who care, helper people and light workers are not supposed to help people who won’t help themselves. It’s very dysfunctional and we’re done with dysfunctional. That is chaos and usage. Karma is coming your way and karma is coming people’s way who continue to sit in fear and are so willing to let our entire society shut down just because they’re scared and can’t think straight.

There is a reason this is happening. You either adapt to the new environment and energies or go. I didn’t make this plan. I’m just relaying it on a White Wind gateway because the human species has life to live and we’ve been given a lot of information that is about to come to the forefront so we can really change this planet. Let’s get cracking!

MOLECULAR LINE-UP

The middle one in the pink boxes is phenylalanine and tryptophan on the other side. They are almost the same, as usual; a synchronicity and no doubt key to protein folding.

Glycine is White Wind, Phenylalanine is Red Earth, Glutamic Acid s Yellow Human, and Blue Storm is Tryptophan.

The Sun and the Solar Tone of Intention in The Matrix


Solar means sun. Today, solar energy is redundant in that we have the archetype of our star, the Sun as the Theme (a Stop Codon), and Tone 9 which is the solar tone of intention, light, life, realizing life and universal fire.

The Sun is in fact MIND, Big Mind as the Taoists say pulsing to us the scuttlebutt from Galactic Center. So much is going on right now. What has to be internalized asap in order for us to make this evolutionary leap is that OUR MINDS are…our bodies. Our immune systems are controlled by our minds and intentions, not by microbes. The microbes FOLLOW the magnetism of our minds. The virus SERVES evolution and is in fact, RNA in the case of a retrovirus. Due to that, it is constantly mutating and stands ready to turn into anything we unconsciously or consciously create. That was proven long ago. Even the M.D. admits the power of the mind and will over the body.

The microbes are not in charge. Microbes are very vulnerable to the environment (they die easily) and to the various defense mechanisms in our bodies. The media, if you listen to it like it’s God, has people’s MINDS programmed that this microbe is more powerful than you are. If you want and need it to be, it will be. They portray it as a war which is the beginning of modern medicine; THE BATTLEFIELD. That’s the number one mantra of course from the sick care system because they have a ton of profit to make off of convincing humans that they are SUPER WEAK and vulnerable like little children that need parents who are stronger and smarter than them. If you feel that way they’ve got you where they want you, you’re programmed and need to turn OFF the media and get meditating and tuning into your breath and your body. If you don’t, they’ll send you over the cliff as soon as they decide to flip the switch. Maybe that’s what you want.

I actually accept it now; that most people will not do the work of focusing their minds and bodies enough to become a co-creator. I really do accept it even though it’s not necessary.

The Moon is in Aquarius so we some action with Uranus opening up. Pluto is the mediating planet though between the Sun Tribe and Blue Storm tribe and it is quintile so we may be in the mood to challenge ourselves. In addition there is a square between Mars and Mercury both retrograde so communications could be snafu.

MOLECULAR LINE-UP

a

In the Matrix, What We Call Coincidence is SYNCHRONICITY


The top right picture is Bell Rock in the Village of Oak Creek, AZ. I used to live there and hiked all around that vortex. It was very electric and upward flowing so it wasn’t my favorite, but I am very familiar with the area.

It is crazy to look at our marble blue ball called earth and realize we are all little ants on the back of GAIA running around having fits and making a mess. She would like it if we’d sit still once in a while and get synchronized to HER cycles and clean up after ourselves. If nothing else, this plandemic has made people sit still.

Tomorrow is Full Moon Lunar Eclipse in Capricorn. Organization and self-discipline are on tap. Watch for epiphanies given to you via synchronicity. Saturn is the mediating planet for Yellow Warrior and Blue Night.

Synchronicity is organized math applied to human intentions, thoughts, feelings, and contracts with other entities to learn soul lessons. You can actually stay on the planet as long as you want if you program your mind and belief to the truth of timelessness.

Aging is defined as cellular stress. We have 100% control over our mental stress state. There are scads of ways to stay in your own vortex, focus on your own body and control your physical life apart from the group programming rife in the media and all around us.

It takes navigation. If you follow others flight plans and internalize the group think flight plan you will traverse the road that they all follow by default; define yourself by your linear age, truly believe that your body is destined to decline (it’s not), get sick, suffer, die and be buried.

Today is Red 6 Rhythmic Earth and it’s all about keeping a beat to your own internal rhythm. If you follow the social beat you will decline because it’s not your biorhythm but a group biorhythm programmed for the group FOR PROFIT for the elite to feed their industries. Humans are fodder to them. They have an endless amount of distractions to pull your mental focus off of all the grand creative and timeless energy you have as a beautiful soul so that you’re giving your mental and emotional energy to them. It’s a hungry 3 headed monster that hopefully will be dispelled with Disclosure at the Federal level. They eat their young. It’s actually already happening.

This programming is largely unconscious by the majority of people because we deem it “normal” to do what everyone else is doing. In fact, we don’t want to miss out. Why? Because it’s your God. You don’t follow the God of your body, your own timing, breath, and inclination. You follow what everyone else is doing because it feels safe. If you didn’t, it would be weird, they’d call you names and people would stop liking you and the opposite sex would want to stop having sex with you. Not.

There are millions and millions of us who are not followers but are on a spiritual synchronicity path that gives us the healthiest, highest quality of life of anyone on the planet. We live in tune with the cycles and ourselves. We all have a different names for God or Source but we know “they” are real. They are one with us.

You begin to see this internal source through observing synchronicity around you. The attributes of Red Earth are; evolve, synchronicity, navigation, tracks clues, grounds, collects synergy, governs earth force, shields, earth keeper, crystal healer, liberal, and confident. Understanding the Tzolkin Harmonic will tune you up to be able to see the synchronicities, feel them and wake you up!

MOLECULAR LINE-UP FOR THE THEMEPLEX

Isoleucine and Valine look identical to me so that’s synchronicity. Notice the Saturn hexagon in phenyalanine.

The mediating planet is Uranus which rules Aquarius. The 5th dimensional GForce is Blue 8 Night; Galactic dreaming and abundance.

Saturn, Jupiter, and Mars All Over the Place


WEEHAWKEN, NJ. – JULY 4: The New York City skyline is seen in the distance as fireworks explode over the Hudson River during the Macy’s fireworks display July 4, 2009 in Weehawken, New Jersey. It was the first time since 2000 that the Macy’s display took place over the Hudson River and not the East River. (Photo by Yana Paskova/Getty Images)

Yellow 5 Warrior has Saturn as it’s mediating planet. Guiding it though is Yellow 5 Seed which is governed by Jupiter. The rest of the themeplex is Mars. In addition, Jupiter is aligned with Pallas. This asteroid was named after Pallas Athena, daughter of Jupiter (better known as Zeus). She was a goddess of warfare, wisdom, skill, and strategy so that is an exact synchronicity with Yellow 5 Warrior in the Tzolkin.

Tone 5 is the overtone of radiance, beauty, command, and empowerment. They are the coaches of the Tzolkin and instill self-esteem, hard work, and discipline in the players.

The 5th dimensional GForce is Yellow 9 Seed;

I pulse in order to target. Realizing awareness I seal the input of flowering with the solar tone of intention. I am guided by the power of universal fire.

It looks to me like we can keep our chins up and re-work the meaning of this holiday weekend given our current national situation. The truth is, the U.S. is NOT very independent from England. Their money funded the Federal Reserve. I’m not sure what the situation is now. Neither are we very independent from one another. We are dependent on one another, especially physically. When it comes to viruses, our immune system functions as ONE and we are being prevented from doing that right now due to biased illusions about being separate from other human beings or the value of human cultural groups compared to others.

MOLECULAR LINE-UP

Notice the synchronicity of the pentagon as a shape in the histidine molecule that is known as Yellow Warrior. Alanine and valine, the analog and guide power are almost exactly the same as are Threonine and Serine, the antipode and hidden wisdom.

Yellow 5 Warrior Themeplex

Histidine is in the center, Alanine is on the right as the analog, Valine is above as the guide power, threonine is on the left as the antipode and Serine is underneath as the Hidden Wisdom.

Yellow Warrior, Blue Night, Yellow Seed, White World-bridger, and Red Serpent.

Self-Existing Vision, Which You Won’t See If You’re Looking at What Everyone Else is Looking At


Tone 4 is Self-Existing

The word “wrong” is a bit judgmental. There is right and wrong in the Universe but it usually applies to math only in an absolute sense. Almost everything else is relative to the outcome you’re seeking. That’s why there is no judgment no matter what anyone accuses you of or what you accuse them of. There is discernment though about a person’s character based on THEIR ACTIONS, not their words. Talk is cheap.

Do you know what outcomes you’re seeking in your own life? What are your unique traits and visions that you would need to work on to manifest? Do you have a vision for yourself? We can put in a request for our vision “for humanity” but we have no control over THE GROUP. Our biggest power is over our own bodies and minds. It’s ironic that that is the first thing we hand over to people we think are bigger, stronger, richer and more powerful than we are. They aren’t. They actually rely on us giving over our heart and minds TO THEM. That’s what politics and T.V. are all about; both parties. If you show or tell them that you’re not interested in handing anything over to them they will respect you and stop expecting you to obey them. Too many people are afraid of community police, leaders, and politicians. They’re JUST people who many times have done quite of a bit of lying to get where they are. They aren’t that powerful. The biggest power is to sitting in authenticity in your truth. It’s very rare. Artists do it and we are at the fringes of society because of it.

The Tzolkin archetype today is Blue 4 Eagle. It’s about measuring, forming, and defining our thoughts, ideas and visions. There energy is there for it today. Tone 4 is like a potter at the wheel or a music composer working on a score. How is it taking shape? Does it look the way you’d like it to? Eagle kin are independent, committed, artistic, compassionate, exacting, visionary, and technically inclined.

The mediating planet today is Jupiter for Blue Eagle tribe and that is in synchronicity with the Moon in Sagittarius. Jupiter rules Sag. Pluto aligns with Pallas and Jupiter tomorrow. We’re willing to invest our energy into solving problems and we can be determined to get to the truth of a matter. Avoid pushing your hatched ideas onto others. Sit with them quietly in yourself!

The 5D GForce is Red 10 Serpent which is curious at this point. I believe we are done with the karma of Maldek governing Serpent and Wizard so there may be a significant biological change with the amino acids Serine and Lysine in our bodies collectively. That is one to watch.

I perfect in order to survive. Producing instinct I seal the store of life force with the planetary tone of manifestation. I am guided by the power of space. I am a polar kin. I extend the red galactic spectrum

MOLECULAR LINE-UP IN THEMEPLEX

  • Blue Eagle in the center is arginine
  • Yellow Seed on the right is valine
  • Blue Monkey above i aspragine
  • Red serpent on the left is Serine whose molecule is almost exact with
  • White Worldbridger on the bottom.

An Electrifying Current of Change; Computer Programming.


Tone 3 is the Electric Tone. Its attributes are bonding, service, and activation. For those that follow the Tzolkin, electric means using our time as a vital force for good; not so much a byproduct of lightning. Electricity has alternating current and direct current as does the earth and our bodies. It’s all one. But our DNA and consciousness do as well.

This is a pretty straight forward depiction of how electric current flows in 3D. I’m guessing it can become a bit more complicated under different physical influences. But look at the black line in the middle…Time. In the book, Earth Ascending, page 71, Map 19, Jose Arguelles defines the actual currents as pulses. One is negative, the AC pulse or aboriginal continuity, and one is positive, the CA pulse which is civilizational advance.

The 3D flow of electricity

“Aboriginal Continuity contains the entire blueprint of psycho-cultural development of the total bio psychic organism, human polarity flow; “Future” to Present = Vision. Information flows in whole patterns and is conservative.

Civilizational Advance is a complementary pulse. It’s the dynamic implementation of the vision. The polarity flow = “past” to Present. The information comes in verbal sequences and mathematical bits. (Computer Programs; binary code) It’s “progressive”. You’d have to really take a hard look at the image below from page 71 of E.A. to see how Jose viewed the movement of electricity as a PULSE through TIME.”-Jose Arguelles

In addition, we find ourselves looking at the White Wizard tribe or the amino acid Lysine activated by Tone 3. Its attributes are enchantment, receptivity, and timelessness. Merlin, J.C., and shamans and wizards all over the world are a potent archetype for White Wizard. Our modern-day shamans might be computer programmers, especially quantum computer programmers. They code with the qubits which can deal with two states at one time and traverse the chasm between the 0 and the 1 without falling into the nano time pit. I have to study up on what they’re doing but it’s fascinating.

Our 5GForce today is White 11 Worldbridger. That is spectral, dissolving, chaotic change and death.

THE MOLECULAR THEMEPLEX LINE-UP

Remember that these move from center to the right and then left as the day goes. It’s 11:24am EST so at noon we are about to enter the vibe of Yellow 3 Seed, the antipode mediated by Jupiter which is conjunct Pluto right now (the harmonic convergence). We should be able to get some very focused work done.

This is a very grounded, calm line-up. All the right side chains are identical. Notice isoleucine and valine are pretty much identical and those two tribes are always connected in the Tzolkin. They are hidden wisdom to each other.

Daily Meditation is KEY right now.


I’m doing no compliance, obedience, or following at all because the edicts and narratives are 100% wrong. Meditation is going to help you feel more confident now because your mind will be focused and informed by SOURCE, not by human society. I have no emotion or values invested in other people’s choices about meditating, wearing a mask, getting a vaccine, or tanking their immune system. It’s not my place to validate or invalidate anyone’s choice. I’m just relaying what I and millions of others are doing.

We are in the midst of Harmonic Convergence. The first one was June 21; Summer Solstice and the Eclipse. The second one was today, 8 hours ago at 1:48am EST, the 3rd one is July 5th. I’m working the energy daily, not just on one of those days, and everything in my life is improving (money, body, mood, projects). If you’re following along or reacting to the supremely negative energy right now that’s a red flag. No matter how negative anyone is around you, if you’re hooked up to Source and working the energy, your life is improving while the others fall away. There may be name-calling, cut-offs, and attempts at control and commands to wear a mask. Nada. We are FREE on this planet, legally and spiritually to direct our own bodies and lives and it’s past time to do it.

The line-up today is Red 2 Stabilizing Skywalker with analog White 2 Stabilizing World-bridger. “The polarizing tone knows that there is a delicate balance in the world that we are always walking a tightrope of wholeness and separation, of integration and release. “-Another World App

The Guide Power is Red 2 Serpent; survival, instinct, and life-force until noon. There is a RESET going on and the human race is polarizing, stabilizing, and waking up for SURVIVAL! It’s totally up to us. Whatever forces we THINK have authority over us know that they DO NOT if we all engage our MINDS, focus our INTENT and HEARTS on what is good and right for the planet and then DO IT and be free. Think about the peon politicians, a handful of crazy people. They have no power against the masses and history has shown it. They will NOT be allowed to use nuclear weapons against us or the Earth. Our helpers have stopped it multiple times and would again. Take your mask off, go about your life, have sex, hug and love your friends, have parties, and use natural remedies to get through these viruses and climate changes. Remember the earth is at a reset point also and we may see some strange new insects or animals, as well as foliage, looking different. Life is ONE.

MOLECULAR LINE-UP

We get to see some key interactions today. The first molecule shows how Red Skywalker (glutamine) and Yellow Star, (Leucine) intimately interact. The second picture show how similar Red Serpent (Serine) is to White World-Bridger (Threonine). W.W. tribe brought more carbon into the mix as humans had to settle here after the Maldek disaster. Red Serpent mediating planet is Maldek and Red Skywalker∞White Worldbridger are mediated by Mars. Mars was Maldeks moon at the time.