Watch “Ancient Aliens: Ancient Alien DNA (Season 10) | History” on YouTube
I wonder if they worked with Operation Paperclip? This link is really something and just brings up more questions for me. Be sure and look at this website and it’s videos and the video below.
8Histidine is the Amino Acid of a Galactic conflict. Still, at least their work was guided by our Sun. But look at the antipode; 8Threonine is death and change. And there is 6Serine, the Reptilians underneath. It’s pretty straight forward. “You would be wise to keep some of what you see under your hat for now.” The Reptilians back in 1953
Crick asked himself how it was possible that nature had simultaneously invented two mutually interdependent elements of life: the genetic material –nucleic acids, such as DNA or RNA– and the mechanism necessary to perpetuate it –the proteins called enzymes–.
The synthesis of the nucleic acids depends on the proteins; the amino acids, but the synthesis of the proteins depends on the nucleic acids. Faced with this chicken-and-egg problem, Crick and his colleague Leslie Orgel reasoned that life should have arisen in a place where there exists a “mineral or compound capable of replacing the function of the enzymes, and from there it would have been disseminated to other planets like Earth by “the deliberate activity of an extraterrestrial society.”
The truth is that directed panspermia does not detract from Crick’s thinking at all. Quite the contrary, it reveals the powerful workings of a theoretical, incisive and restless mind, eager for rational answers, even unconventional ones. To understand how Crick came to the idea of panspermia, we must go back a few years. The son of shoemaker Weston Favell (Northampton, UK), Francis Harry Compton Crick (June 8, 1916 – July 28, 2004) reached the end of his childhood with the main aspects of his identity already defined: his penchant for science. As for the first, he chose physics.
Molecular biology might have lost one of its founding fathers had it not been for the war. Crick began his research at University College, London working on what he described as “the dullest problem imaginable” – measuring the viscosity of water at high pressure and temperature. With the outbreak of World War II, he was drafted into the army to work on the design of mines. After the end of the conflict, he discovered that his equipment had been destroyed by a bomb (in his autobiography he spoke of a “land mine”), which allowed him to leave this tedious research.
Crick then had to choose a new field of research, and that was when he discovered what he called the gossip test: “what you are really interested in is what you gossip about.” In his case it was “the borderline between the living and the nonliving, and the workings of the brain,” in a nutshell – biology, or, as a physicist – biophysics. He began working on the structure of proteins in the Cavendish Laboratory of Cambridge, until he met an American named James Watson, twelve years younger than him but already with a PhD that Crick had not yet obtained for himself. Watson & Crick, and their DNA model in the Cavendish Laboratory (1953). Author: Antony Barrington Brown
The two researchers discovered that they shared a hypothesis. At that time it was believed that the seat of inheritance lay in proteins. Crick and Watson thought that genes resided in that unknown substance of the chromosomes, deoxyribonucleic acid (DNA). And that conviction, along with the participation of Maurice Wilkins and Rosalind Franklin, would give birth on February 28, 1953 to one of the greatest discoveries of twentieth century science, the double helix of DNA. The work was published in Nature on April 25 of that year. Crick would not obtain his PhD until the following year.
But although Crick is known primarily for being one of the founders of this milestone of molecular biology, the truth is that he himself laid the first rails of this new science. It was he who proposed that DNA was transcribed to RNA and that this was translated by means of adapter molecules in charge of converting the genetic code for proteins, the building blocks of life. And it was this “central dogma” of biology, as he himself baptized it, which led him to publish in 1973 his hypothesis of panspermia, by then such an elegant idea that it even counted astrophysicist Carl Sagan among its proponents.
Only years later would it be discovered that RNA can act by itself as an enzyme without the intervention of proteins, thus solving the problem that inspired panspermia. In 1993, Crick and Orgel published an article that no longer made any mention of an “extraterrestrial society”. (Who shook that out of them? Scientists have always been pressured to agree with the Government/Military/D.S. narrative)The chicken-and-egg problem “could be resolved if, early in the evolution of life, nucleic acids acted as catalysts,” they wrote.
By this time Crick had changed continents and fields of study; in 1976 he moved to the Salk Institute in La Jolla (California, USA) for a one year sabbatical that would end up lasting for almost three decades. It was there that he settled his unfinished business with the second of his gossips: the brain. For the rest of his career, and in collaboration with neuroscientist Christof Koch, at the California Institute of Technology (Caltech), he devoted himself to trying to locate consciousness in the brain matter. “You, your joys and your sorrows, your memories and your ambition, your sense of personal identity and free will, are in fact no more than the behavior of a vast assembly of nerve cells and their associated molecules,” he wrote in 1994.
He never managed to unravel the problem of consciousness, although he made significant advances in the knowledge of visual perception. In 2004, he lost his battle against colon cancer, but never lost the courage or the passion for the study of life. According to Christof Koch, “he was editing a manuscript on his death bed, a scientist until the bitter end.”
On February 28, 1953, Cambridge University scientists James D. Watson and Francis H.C. Crick announced that they have determined the double-helix structure of DNA, the molecule containing human genes. The molecular biologists were aided significantly by the work of another DNA researcher, Rosalind Franklin, although she is not included in the announcement, nor did she share the subsequent Nobel Prize award for it.
Though DNA—short for deoxyribonucleic acid—was discovered in 1869, its crucial role in determining genetic inheritance wasn’t demonstrated until 1943. In the early 1950s, Watson and Crick were only two of many scientists working on figuring out the structure of DNA. California chemist Linus Pauling suggested an incorrect model at the beginning of 1953, prompting Watson and Crick to try and beat Pauling at his own game.
LISTEN NOW: HISTORY This Week Podcast: The DNA Debate
On the morning of February 28, they determined that the structure of DNA was a double-helix polymer, or a spiral of two DNA strands, each containing a long chain of monomer nucleotides, wound around each other. According to their findings, DNA replicated itself by separating into individual strands, each of which became the template for a new double helix. In his best-selling book, The Double Helix (1968), Watson later claimed that Crick announced the discovery by walking into the nearby Eagle Pub and blurting out that “we had found the secret of life.” The truth wasn’t that far off, as Watson and Crick had solved a fundamental mystery of science–how it was possible for genetic instructions to be held inside organisms and passed from generation to generation.
Watson and Crick’s solution was formally announced on April 25, 1953, following its publication in that month’s issue of Nature magazine. The article revolutionized the study of biology and medicine. Among the developments that followed directly from it were pre-natal screening for disease genes; genetically engineered foods; the ability to identify human remains; the rational design of treatments for diseases such as AIDS; and the accurate testing of physical evidence in order to convict or exonerate criminals.
Crick and Watson later had a falling-out over Watson’s book, which Crick felt misrepresented their collaboration and betrayed their friendship.
A larger controversy arose over the use Watson and Crick made of work done by another DNA researcher, Rosalind Franklin. Colleague Maurice Wilkins showed Watson and Crick Franklin’s X-ray photographic work to Watson just before he and Crick made their famous discovery. The imagery established that the DNA molecule existed in a helical conformation. When Crick and Watson won the Nobel Prize in 1962, they shared it with Wilkins. Franklin, who died in 1958 of ovarian cancer and was thus ineligible for the award, never learned of the role her photos played in the historic scientific breakthrough.
Chemical structure of DNA discovered
Author
HISTORY
https://www.history.com/this-day-in-history/watson-and-crick-discover-chemical-structure-of-dna
March 22, 2021
A&E Television Networks
March 2, 2021
November 24, 2009TAGSSCIENCEBY HISTORY.COM EDITORS
What most people do is eat or drink alcohol more when they don’t want to deal with organizing their feelings. My “go to” lately are frozen yogurt bars. In the past it was bingey potato chips. Humans are addicted to feelings so avoid them. I believe Huey Lewis sang about being “addicted to love” but he meant the sexy, lusty, emotional kind, not the real kind.
The Moon has entered Sagittarius which the Virgo Sun forms a square to this afternoon during Blue 6 Storm. This could create some tension unless you know how to ignore pettiness and gossip.
Big minds discuss ideas, mediocre minds discuss events and small minds talk about people.
Eleanor Roosevelt
That sizes up our media in a nutshell. I guess that’s why I’m annoying. All I want to talk about is ideas and it stresses people out. My big idea with this blog is there is far more to our DNA and who we are in time and in our families than anyone realizes. I’m scoping out facts and research and then adding my intuition to the mix. One would think that would be valuable to a whole lot of people but most of them are busy reacting to what everyone else does or worse, following what everyone else does.
The Theme is Red 6 Moon, Analog is White 6 Dog, Guide Power is itself, Antipode is Blue 6 Storm and Hidden Wisdom is Yellow 6 Human so Mercury, Pluto opposing and Earth are strong players astrologically from the UNIVERSAL perspective, not the astrological perspective.Red Moon and White Dog are mediated by Mercury so the good part is a Mercury-Uranus trine opens us to creative ideas. The 5GForce is Blue 8 Monkey or galactic creativity, playfulness and illusion. It actually comes up as the Gateway in two days. The galactic tone is all about integrity and doing what you say you’re going to do. That creates harmony and a good example for others.
There is definitely a creative restlessness in the astrology and in The larger Matrix. Channeled well, these aspects encourage us to improve but otherwise might lead to over-indulgence, lack of moderation, or exaggeration. We need to be in touch with our feelings so we can moderate our expectations of ourselves and others.
Methionine is the start codon for the mRNA sequence and tryptophan sometimes functions as a stop codon so this could be a defining day or a type of test to see if we’re taking control of our vibe. Look at the similarity between White Dog and Yellow Human. Yellow Human just has the extra COOH molecule.
The tryptophan molecule with the presence of the hexagon and the pentagon is indicative of the influence of Jupiter and Saturn in holding our DNA together in the past. Now that that’s over I wonder if it will be replaced with something else or rehabilitated?
We know all about solar storms these days. There have been very, very strong ones from our Sun that have been affecting everything and everybody on earth in the last few months or so. Nothing on the sun is normal anymore and Earth is intimately tied to it since the Earth was born out of the Sun. Think of the Sun as our father and the Dark of space within which ALL resides as our mother. They are local universe parents.
In addition, The Schumann resonance has been off the charts. The Schumann resonances (SR) are a set of spectrum peaks in the extremely low frequency (ELF) portion of the Earth’s electromagnetic field spectrum. Schumann resonances are global electromagnetic resonances, generated and excited by lightning discharges in the cavity formed by the Earth’s surface and the ionosphere. They are known to affect the human body.
The cause of all of this is it’s time for earth to evolve forward, to take an evolutionary jump and activate our light body at a steady pace and join the universal stream. This is nothing new. Earth, viruses, bacteria, all plant life and rocks, animals, you name it have been evolving for GOOD PURPOSE now for billions of years. Humans are supposed to be part of the natural order and accept it. It’s not acceptable for Earth and humans to become artificial intelligence which has wreaked havoc in other parts of our universe. It’s not going to happen here. It’s only when our eyes and hearts close that we want to control others and have everything for themselves or have it our way. That’s done too.
The 5GForce is Red 5 Dragon of Radiant Blood Mother and Birth. It’s heavy energy that is bringing the power of feminine back to earth.
The body uses tryptophan to help make niacin, melatonin, and serotonin. Serotonin is thought to produce healthy sleep and a stable mood. In order for tryptophan in the diet to be changed into niacin, the body needs to have enough iron.
For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.
As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.
I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.
Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!
The main analyzed regions
Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.
AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC
See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220
TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT
See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:
TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA
I and millions of people meditate daily. I’m addicted to it. I’d put it right up there with great coffee or sex. It’s a tonic for the mind. Humans are different in the animal kingdom in that we have the ability to be self-reflective. I’m trusting my readers are able to ponder their feelings, actions, motives, and past experiences so they can learn who they really are. If you do start to ponder it’s easy for your mind to start to spin with ideas, memories, thoughts, feelings and intuitions.
In order to make some real progress with mental focus, it’s helpful to decide what you’re going to focus on mentally and put the others in a folder in the back of your mind. In order to do that, you must be clear on what you want to accomplish that day and what your time looks like. Make this decision before you meditate. That way, your spirit guides know what you need help with. You decide, they don’t! On other days, I’ll observe some odd inclination I’m having and figure out what I’m feeling to understand why I’m doing it.
The truth is, my life is extremely abundant and I’m grateful daily. I mostly did it myself but definitely had help. We all have help reaching our abundance goals whether they be psychological, money, or spiritual. You have to start by asking for help though which means getting past your ego.
Today is Blue 6 Night which hands us the energy to pulse musically with what makes us feel good, focused and abundant. Let’s keep the definition of abundant open to more than money. Enough money is definitely an important tool but it doesn’t bring health, mental stability or clarity about feelings. I think money is only 15% of abundance. Loving yourself and knowing how you feel is 75% of abundance. Liking your body set up is the other 10%. I guess I’m speaking for myself.
The analog and guide power are Yellow 6 Warrior and Blue 6 Night again. Saturn is the mediating planet. Therefore our minds are disciplined with help from Saturn to decide what we’re going to think about and not think about. There is no compulsion here. Just make a simple decision and do it. Sometimes it’s that easy.
The antipode is Red 6 Skywalker which compels us to movement and exploration in order to distract ourselves from getting our thoughts in order. I am Skywalker and I get bored so easily having to focus on one thing. It’s truly maddening to have to apply my antipode, this Blue Night theme to my mind. I compromise through my writing. Writing allows me to continue o explore the ether creatively while sitting still. I do manage to get things done but they’re not usually as perfect as I’d like them to be.
The Hidden Wisdom is White 8 Mirror, galactic reflection! That’s a good reason to sit still. The galaxy is unlimited and there is so much hidden from us by State and Church. They keep all the info. left on this planet for themselves. Order is one of the attributes of White Mirror though so we have double, maybe triple help getting something fruitful done. Have a great Thursday.
We see the Jupiter pentagon on the histidine molecule while the Moon is in Sagittarius. Jupiter rules Sag . And we see the Saturnian hexagon on the tyrosine molecule with the Saturn attributes or order, discrimination, ritualistic, discipliner, well coordinated and practical.
I’ve bothered to bring ancient wisdom and systems of organizing and seeding DNA on Earth down to the molecular level because of free will guiding evolution. The attribute of free will is manifested by the Yellow Human tribe. Up until now, evolution has either been esoteric and in the realm of New Age Religion or in the lab with the reductionist geneticists using Crispr to slice and dice our DNA.
All religions have been a step forward for humans except for the superstitious parts that require no critical thinking. Generally you have a prophet, a seer, a visionary and a teacher. The new age movement has plenty of those types and unfortunately there is usually some strong, intelligent woman behind the Kings throne to keep him socially cued in. I still see it everywhere in 2020 and she still has to be beautiful and hang on his arm. She is capable of being the leader, but even in the New Age religion, men are men. They are egos that need to try to get territory and dominate because generally speaking, they’re not as strong as women. We tend to dominate this planet, walk into a room even with our shirts on and the men’s mouths drop open. Women have tremendous power just by our physical presence. That’s not the effect men have on women but we are most definitely paying attention and appreciate beauty. Well, I am. I love the line on “Big Bang Theory” where Leslie Winkle says, “Come for the breasts, stay for the brains”. That’s gold. Most men don’t stay for female brains unless they have brains themselves but being men, they need to feel dominant so many times will pick a woman less intelligent than him. Smart women still end up alone much of the time no matter how they look.
On Earth, we still have a problem with the subconscious programming of gender roles seeded in us by our parents generation who went through tremendous trauma to survive the cabal and their nefarious lies and actions. It may take us a while to heal that. In that sense, the New Age religion has been no different.
However, now it’s time to seed a New Science that has at it’s foundation the intended oneness of Mind, Body, and Spirit. Our body IS our Mind and IS our spirit. There is no more degradation of the body, women, sex, and celibacy. We know synchronicity is real and that in the Matrix it’s not about coincidence, ever. Everything happens for a reason.
But today’s Theme, Red 13 Earth TRANSCENDS synchronicity which is an attribute of Tone 13. Cosmic kin transcend, have presence, and endure. We go past what is normally understood or seen and are therefore leaders for the people.
Trees are archetypes for EVOLUTION. Red 13 Earth kin navigate the Matrix, transcending synchronicity in order to EVOLVE. The great lesson of this kin is that on Earth we have the power of birth, intelligence, freewill, and SEEDS. Yellow 1 Magnetic Seed in the Hidden Wisdom. All good things on earth come from seeds and we must respect and guard them well. Why? Because seeds are little DNA packets. They are time travelling pods and ensure the future of Earth and our progeny; animals and plants.
Given all of that, the edicts of control, fate, the gods, and destiny are cast out by Earth’s children. We create our own destiny. There is no fate or control of the gods as told to us in Greek myths and others. The Tzolkin doesn’t even control us; it just organizes the Matrix. Everyone’s intentions IN TIME have to coalesce in an orderly fashion or there would be more chaos than there already is.
The analog support is White 13 Wind. This is divine breath, God speaking through evolution. I’m down with that and I’m listening. The Guide Power is Red 13 Dragon, Rupert Sheldrake’s birth theme. He teaches morphic resonance. That melds perfectly with terrestrial evolution and divine inspiration.
Morphic resonance, Sheldrake says, is “the idea of mysterious telepathy-type interconnections between organisms and of collective memories within species” and accounts for phantom limbs, how dogs know when their owners are coming home, and how people know when someone is staring at them.
Sheldrake is inferring what Arguelles inferred all the time; DNA is Time.© There is Interconnection between a DNA organism and collective memories which are time, is the way I would say it. And it’s not mysterious. I have it figured out and I’m putting it in a database to be analyzed. There is rhyme and reason to it.
The antipode is Blue 13 Hand or ongoing healing. I swear I’ve been a healer in every lifetime from planet to planet. I could do it in my sleep. My hands are so attuned to the natural body I can’t fathom calling myself a healthcare worker and not touching the body. It’s so bizarre to me. The boundaries are in my mind. I wouldn’t dream of crossing pa physical boundary with a patient yet sometimes I feel they want me to given the tremendous dysfunction in our society with regard to the body.
No one touches anyone with kindness. When a bodyworker does touch them with kindness and excellent therapy, some are confused. It’s a travesty. The human body is OBJECTIFIED because of our psychotic sick care system and no one is educated about how their body actually works. The doctors aren’t even educated that well. If Church and State can keep you ignorant about the unlimited power of your body to heal, bring pleasure, and accomplish what you wish, they can control you. That has been the status quo and is even now with this planned virus event.
The bottom two, isoleucine (Blue Hand) and valine (Yellow Seed) are identical. The power of the Earth and it’s elements TO HEAL naturally is deeply seeded on Earth.
For the record, Dr. Chavez validates the work I’m doing in Time Science. He is a molecular biologist and works with DNA in the lab.
9 hours ago
Whatever They Make and Market is Either Culling or a Placebo. It’s Not Medicine.
Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.
As you skim, please be sure to read the highlighted areas.-Lisa T.
https://www.minervanett.no/…/13/TheEvidenceNoNaturalEvol.pdf,
This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.
“The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte“
“SARS-CoV-2 is possessed of dual action capability“
“Simultaneously it is capable of binding to ACE2 receptors“
“The likelihood of this being the result of natural processes is very small.”
“The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”
“A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”
“Why does this matter?”
“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”
“the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved“
“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”
“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”
“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”
“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”
“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”
“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”
“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”
“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”
“a designed mutated strain (initially) lacking the furin cleavage site residues was used”
“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”
“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:
1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!
“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”
“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”
“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”
“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!
“typically the objective of gain of function experiments… a strong indicator of manipulation”
“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”
“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!
Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”
“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”
“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.
“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…
“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!
“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!
“we now add here a forensic analysis”!!!!
Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:
“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”
“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”
“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”
Note:
So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!
But the fight continues as follows:
“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”
And the next one is a “classic” of infamy:
“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”
“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.
“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”
“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”
“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”
“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.
“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”
“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.
So, “the reconstructed historical etiology of the Spike (is) as follows:”
“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”
Conclusion
“We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”
Additionally, in this wretched document;
https://apps.who.int/…/annual_re…/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/…/annual…/GPMB_annualreport_2019.pdf ),
We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”
Welcome to another day in the matrix where synchronicity with All That Is are the road signs, as long as we’re paying attention. This blog is an attempt to free your VISION so that you glide easily between inner vision of yourself and your body and the outside world, or what we perceive as the outside world. I believe it’s actually ALL ONE Big Mind in the illusory hologram that we perceive with our five senses.
For thirty years I’ve witnessed and been personally involved in amazing, unmistakable synchronicity that can be explained no other way. So have countless others. But there is still this outside screaming chorus of CONTROL from the spiritually ignorant, greedy, bitter victims and psychopaths that would have us believe THEY are in control of the Matrix. Yeah, no. But in this local universe they are free to try up to a point. I can tell you that the E.T.’s helping us have time and again shut down our nukes and that will continue. They are not allowed to destroy the human race or the Earth. It’s in the contract.
The Matrix command and control is Galactic Center. We live in a Grand Universe that is organized according to Love and Light but because of free will, dissent, evil, violence, resistance and mischief are allowed to exist. There are 300 species of E.T. alone on THIS planet, underground, among us as humanoids, and in our local solar system. They are NOT a threat to us but we are EVER SO MUCH to them because of our unwillingness to control our drama and bodies. Humans need to get with the program and become CO-CREATORS instead of reacting like little children all the time. E.T.’s are just people. Hopefully soon all will be disclosed and the intelligence they’ve left us will come to the surface.
Today is Red 5 Moon or Radiant Methionine which is the START CODON for the tRNA in all RNA sequences. It’s attributes are; purification, flow, and universal water. I talked extensively about water, hydrogen, and the tetrahedron yesterday without realizing that TODAY was the Water archetype. It’s analog is White 5 Dog which is Radiant Love. Red 5 Earth is the Guide Power, Blue 5 Storm is the Antipode and Yellow 9 Human is the Hidden Wisdom. The nutshell of that is, our bodies and feelings are bonded to Love and Loyalty. That truth is our accurate NAVIGATION in the matrix. Notice I didn’t say we ARE our feelings or that we should SIT IN our feelings. They are just road signs and then should be released. But don’t ignore the road signs in the Matrix or you’ll go off your rails. Our challenge and gift is to use that to catalyze SELF-GENERATION and INTERNAL ENERGY or QI. As Solar children, children of the Sun and the earth, our wisdom is to accept who we are in this incarnation. Follow the Sun cycles and the Earth cycles, not humans and their institutions. We have free will and real influence with other species. We are creators and holders of the chalice, the Holy Grail. We are vessels of a higher power and some would like to steal that from us. Hold your boundaries with the FOCUS of your mind. Navigate your body and mind. The Universe has your back. It’s not useful to offload your story or drama onto other people right now. Just align your daily behavior with your internal power. People can feel it. Act more, talk less.
Just for fun, look at how similar the scientists depiction of a tRNA molecule looks to the Tzolkin Themeplex. Again, synchronicity. Just flip it to the right. The antipode/anti-codon is on the left.
Today is White 2 Worldbridger which is the amino acid Threonine. Tone 2 balances and stabilizes by polarizing. Attributes are change, death, equalizing, opportunity, surrender, transmutation and grounded in spirit.
Our DNA is binary in it’s movement and is two strands. Stabilizing change is sort of what this planet is all about so we can evolve forward. We are going through that right now. The viruses are pure RNA and DNA. So are bacteria by the way. They are not our enemy or contamination. The DNA of most bacteria is contained in a single circular molecule, called the bacterial chromosome. The chromosome, along with several proteins and RNA molecules, forms an irregularly shaped structure called the nucleoid. … In addition to the chromosome, bacteria often contain plasmids – small circular DNA molecules. Bacteria and viruses are made of the same stuff we are but they are much more simple organisms. Nevertheless, they are ONE with us from the beginning and help us ADAPT to this planet.
Our greatest enemy is OURSELVES; clenching our minds in irrational fear and allowing ourselves to be programmed by outside forces; people and media because we are SO out of touch with our bodies and the earth. The real contamination are our HABITUAL, IRRATIONAL, negative thoughts, feelings, fears and letting other people be our Gods and we feel we have to obey. All of that is wrong and has contaminated the planet. It will kill us if we don’t turn it off and get meditating, exercising, and loving ourselves. Again, that’s what all of this is about. There is nothing communal and considerate about people obeying each other out of fear and then taking actions that will not have the desired outcome; something good.
I’ve also noticed that those who are introverts want and need to be out and about more and know we need to be in personal contact with people again and those that are extrovert, the majority of humanity, enjoy working at home now and not dealing with people at all. I’ve been doing that for 20 years so…yeah! I need to get out and I’m stopped at almost every door by a mask. Not doing it. I just have people to my house.
The tables are turning. The introverts who have an active mind, independent, take care of themselves and love being alone are going to LEAD. This is a stabilizing influence. The truth is, humans are ambivert; both enjoying the company of others sometimes and being alone.
The microbes purpose is to challenge our bodies to come into better alignments with universal energies. That doesn’t seem to be understood by the medical establishment but many people are having pineal gland activation with the Covid19 virus. I sure did. It changed me. The pineal gland is the third eye, right in the middle of the forehead, behind it in the deeper brain. It’s a literal gland and has to be activated now.
Threonine and Glutamine both have polar uncharged side chains and histidine and arginine both have electrically charged POSITIVE side chains. All of them are hydrophillic water loving.
Tyrosine is a hydorphobic A.A. and doesn’t like water, or emotions. It is White Mirror and can sit there and look in the mirror and feel nothing. It’s just examining things. All in all it does balance out the themeplex. Until noon today we are under the strong influence of White 2 Mirror. The afternoon is always dominated by the antipode and today it will be Yellow 2 Warrior or stabilizing intelligence.