Anti-Covid19 v.2


I’ve been in Messenger with Dr. Chavez. I needed to delete my last post by him because he feels his life is threatened. There are more details I will not disclose. But I have been allowed to post portions of this paper. It’s 62 pages long and this is just the first 7 pages. Dr. Chavez is a PhD molecular biologist who has studied the CV2 sequence extensively.

I may post another section tomorrow Enjoy! Lisa

COVID-19: Hypothesis of the Lab Origin versus a Zoonotic Event Which Can Also be of a Lab Origin

By Dr,Fernando Castro-Chavez.[1]

Abstract:

To treat the cause of a disease and not only its effects are of the utmost importance; hence, we need to know the origin of this pandemic of COVID-19, to be able, if possible, to prevent an event of such a nature and magnitude in the future, and to be able to avoid all sorts of abuses to humanity, as is happening right now. Bullet points here addressed are:

1) To have, inside the backbone of a virus from a bat (mostly ~97.55% of the viral RNA (by deducting the HIV inserts found by Perez, Montagnier and others), & as per the findings of Petrovsky, see below, and also to contrast the differences), the insertion similar to that of a pangolin virus for the Receptor Binding Domain (RBD, which basically consists of six separated key amino acids, or the 0.06% of its genome for these particular 18 nucleotides), being their receptor the ACE2 of the human lung, appearing at a time (as earlier as since September of 2019), were there were already mature all of the molecular methodologies necessary to modify individual nucleotides (Crispr-Cas9, “Seamless”, etc.) that then modify at will the resulting amino acids, with the possibility to give an extra passage to the virus through ferrets (or other lab animals) that have an ACE2 very similar to the humans, to give it then a more “natural” appearance (by random trivial changes); because, had it been natural, this could had required an animal host infected with these two viruses simultaneously, and that with an unexplainable marksmanship, to specifically modify the key six codons (and a second independent of such impossible recombinants, to give raise to the differences exclusively present at the end of the long Orf1ab, into the Nsf15 and Nsf16);

2) To have an even more important and unique peculiar site, PRRAR (encompassing the needed 12 bases to complete that sequence, being this the 0.04% of the full genome), for protease cleavage (new to Plasmin and Furin, plus Trypsin, TMRPSS2, etc.) inside the protein called Spike (S), to obtain the fragments S1 and S2 to allow the viral RNA to penetrate the cell (expanding the range, not only to lung cells as the previous modification but also to white and neural cells), whose nucleotides producing it are highly strange to the rest of the viral sequence, because they contain more than an 83% of richness in its nucleotides GC, being these 12 nucleotides alien to the rest of the virus: CCUCGGCGGGCA (similar to bacterial and to methodological sequences patented by Moderna, Inc., cleavable by restriction enzymes BsaJI, AciI, Cac8I, MnlI…), that are engrained to the three remaining bases: CGU present in the frame of the bat virus to complete the necessary sequence. This will require, either a third virus completely unknown until now, either in the same utopian animal described before, or through a second passage of the first chimera into another animal, and then that such viral beast, could also be able to target exclusively this region, and no other site whatsoever; then, it is explored,

3) The biggest shot in variation, when it is compared to the first sequence obtained of the virus of COVID-19, with its immediate ancestor, that according to Shi Zheng-Li is the RaTG13 (submitted a posteriori of the COVID-19 first sequence, and which researchers demonstrate that this is a partially made-up sequence (see below), having her deliberately ignored even to cite her previous identical reference called BtCoV/4991 (2016), or even her most recent reference of the same that she put under the name of SARSr-CoV Ra4991 (2019), being very dishonest for her to change in at least three identified times the names of her same sequence, actions that render her highly suspicious, because she hid the rest of the sequence at least during the last four year (having been obtained from excrement in a cave, she says, after a call due to a serious case of miners infected at Yunnan, and nobody knows still what was inside those at least six miners), but her publishing it until now, after the emergence of a similar virus, makes her highly suspicious, rather than making her look innocent; and, who can say that she did not manipulate as well artificially such sequence, or that the CCP Chinese military did not do the same to the other two previous sequences that are also somehow similar to Sars-CoV-2?, and how many more hundreds of sequences will they be hiding?, because nobody independently has been able to verify the accuracy of their claims, being everything based only in what they say), given that the nucleotides of six proteins exhibit a 99% of similitude between both sequences, while twelve of them go down to a 96% or even are below of this number, being the most extreme changes, the ones that are inside the sequence for the protein Spike, which while exhibiting a global similitude of 93%, is the one having the highest discrepancy between the two sequences, and within this same one there are extreme shorter variations, with a low similitude of 44% on that specific of the RBD mentioned before, which goes down to some 17% for the region of those 18 key bases, and of only the 20% percent for that sequence of 12 bases for the resulting protease cleavage site; other changes include the optimal nucleotides of an even shorter region of 16 segments similar to immunodeficiency genes (plus two more distant ones), and even a couple of concatenated Plasmodium yoelii found by Perez and Montagnier at the S2 place, all that could be better explained with artificial processes already in place to do this and more within the frame of the awful Gain-of-Function sinister and dual-purpose (or double-talk) research. So, it is their word against the world, and that is why since at least 2010 I have been proposing an independent verification by at least three other labs of results reported, especially by CCP Chinese researchers, as they did cost me already my first job in the US by their lying during at least ten years about a methodological artifact that I called “Palindromati”, and that they kept on reporting as “natural” while receiving grants to explore a chimera, and how more is it costing their apparent lying about the artificial origin of COVID-19 at this time?) So, all of these points and so much more, because Jesse Morrell, for example, is reaching a set of almost 40 (and counting) pieces of evidence of a lab origin versus cero otherwise, things and persons that are leading us to conclude that it is evident to see that there was human intervention in the emergence of this Sars-CoV-2 virus because in 2015-2018 there was not in existence any zoonotic history of any class in Wuhan, so, having been originated this virus already mature and fully capable to attack the human population, implies an artificial “injecting” source.

“…have no fellowship with the unfruitful works of DARKNESS, but rather expose them. For it is shameful even to speak of those things which are done by THEM in secret. But all things that are exposed are made manifest by the LIGHT…” An inspired Paul inEph. 5:11-13.

Dedicated to Francis S. Collins, so as for the many to be able to see…

Introduction:

A balanced set of voices is needed in this COVID-19 Pandemic, and such is the purpose of this work, to speak the pros and the cons of every claim. I also want to make this presentation a personal one, as scientists tend to simulate isolation of themselves from their research. But in the end, they are still as human as anybody else and their personal bias and experiences always show up. So, here we will be just another lonely human. Especially within this Pandemic that has tended to “dehumanize” humanity. So, here am I, back to the simplicity of what is meant to be “human” and with feelings. Three pieces of evidence in science are normally required to establish something as evident (Crombie, 1994). In this case, we will see three minimum reasons, and one more to give a certain range of tolerance (plus another at the beginning, aimed at those with eyes to see), and this will be the determining factor in identifying if COVID-19 is artificial or otherwise, which will show prominently to the reader that this COVID-19 virus is of a human design. Currently, there are zero shreds of evidence in favor of the opposite view.

I hope that other scientists, especially all those honest virologists, immunologists, infectiologists, epidemiologists, molecular biologists, human physicians (excluding those “inhuman”), veterinarians, etc., etc., are also doing this kind of vital work, as it is to “Define the origin” of this COVID-19 pandemic, which is mainly devastating morally the people of this planet (humans against humans), and needless to say, devastating the infected victims (from all of those tainted statistics that we are all aware of).

It is necessary to know the truth to prevent something like this from happening again, and to prevent a recurrence in the course of the current pandemic, as there is still the slightest chance that more of the same pathogens will continue to be released with the purpose of “escalating” such crisis, which by all accounts has been designed globally, but with the final target of the USA. The fact that an official denial appears in all articles related to the human engineering of COVID-19, saying that: “There is no evidence of it”, indeed speaks volumes about a deliberate attempt to silence the truth, as well as does the unrequested invasion of our privacy by the WHO in all social platform available on the internet, and the censorship by the same WHO under higher orders, of every posting or video that does not agree with the narrative that they pretend to impose over the whole of the human race.

Here, I present then, this minimal evidence that shows just the opposite: That “there is evidence” indeed of a lab-leak, and even further, of an even engineered virus as the most plausible explanation of the current malady, as if planned. This is presented for the free evaluation of the reader.

This work is also an attempt to respond to the most recent question posed in Nature, talking about the WIV of Zheng-Li Shi: “The lab does hold coronaviruses related to SARS-CoV-2, so it is possible that one could have escaped, perhaps if a lab worker accidentally became infected from a virus sample or animal in the facility and then passed it on to someone outside the facility. It is also theoretically possible that scientists at the lab tweaked the virus’s genome for research purposes before it escaped, but, again, there is no evidence that they did. Shi declined to respond to Nature’s questions about her experiments, saying that she has been inundated with media requests” (Cyranoski. 2020) So, Shi, the main suspect in this story is declining to explain her research, however, in what she has published thus far there is vast evidence that COVID-19 may have been designed there at the WIV, the evidence available for anybody willing to dig into her publications. This article wishes to help a little on that aspect.

Antecedents:

Most recently, before the release of his second article on the subject, Birger Sørensen declared: “I think it’s more than 90 percent certain. It’s at least a far more probable explanation than it having developed this way in nature” (https://archive.vn/Wmj9p), where he also explains that the adulterations go beyond the attachment to the human ACE2 receptor (shown in my first point) and, it is within that spirit that I present my current work. So, I name this study “Anticovidian v.2” because it is in line with my previous collective research into Antiobesity (Castro-Chavez et al., 2003) and Antiatherosclerosis (Castro-Chavez et al., 2013), where I also demonstrated, as I hope to do here, that a contaminating laboratory artifact had intruded on thousands of sequences present in the Genbank and even in the Affimetrix Microarrays (Castro-Chavez, 2012). In this viral case, a most basic antecedent I would like to emphasize as many have done, and this is the article by Baric & Zhengli (Zheng-Li) from 2015 (Menachery et al., 2015), published within the time in which Obama had advised a moratorium for such studies, moratorium which lasted in the US from 2014 to 2017, and in the end, it was when, Obama before leaving office indicated its reactivation until the ban was finally lifted by Francis S. Collins (Morrell, 2020). However, in disregard of that ban, these authors managed to continuously publish their work, which again aroused an ethical conflict during that year (Akst, 2015), and as they continued doing Gain-of-Function research non-stop in Wuhan at UNC.

The experiment they carried out was to develop a super-coronavirus that was capable of killing elderly mice, a result that they do not present, as it would be expected, in the main text, but rather in a compound figure in their supplement (Fig. 3b), in which the complete death of elderly mice is observed on the fourth day (Menachery et al., 2015). In a recent interview with Baric, it was indicated that this murderous virus was “found”, but the truth is that he, with Zheng-Li and one peer, plus his team, “designed” it, but did not “find” it as it was deceivingly reported on 2020: https://www.wral.com/unc-researcher-found-deadly-virus-in-bats-in-china-in-2015/18913313/ (whose headline has been saved at https://archive.vn/DI2mT). But, just from the onset, you can start seeing that there is the desire by the seriously conflicted actors, for all of this to remain hidden or changed.

Remarkable in this Menachery et al. (2015) work is that two of the authors came from Wuhan, where the COVID-19 pandemic broke out, and that they are credited with having brought both the necessary plasmids, as well as the murderous version of the modified gene “Spike”, a key protein for viral entry into the human cells, and that Baric just now deposited its sequence MT308984: https://archive.vn/P5ay7

Now, it has been discovered that a handwritten version exists before the final version of this 2015 article by Baric for the journal Nature Medicine (now under Chinese control), and it was the first version format to be published by the NIH PubMed; what is noticeable about this previous version, is that it has two more and key methodological references that are not present in the final electronic version (Menachery et al., 2015). Art Bobroff, through Facebook, indicates that the removal of those two key methodological references is a standard procedure in GoF research, to comply with the “law” about this kind of risky research; it may be so, but indeed those references are very telling.

The first is from 2005 and shows that the Spike protein site called the Receptor Binding Domain (RBD), was also very well known, focusing since then as well, only on the six key amino-acid contacts within the so-called then RBM, Receptor Binding Motif, currently known generically as RBD mostly due to Andersen et al. (2020), whose work has been multiple times debunked, such as in Stout (2020, thanks to Rubio for the reference), which is responsible for the attachment of the virus to the receptor of the lung cells called the ACE2; in addition, since then, the state of the underground molecular art allowed already something like single nucleotide changes to be made on individual nucleotides (already known, but later made into a CRISPR/Cas9-deaminase methodology: Shevidi et al. 2017), which in turn would modify the resulting amino acid, and in such article, its authors focus on modifying the key amino acids necessary to improve the RBD binding to the ACE2 (Qu et al., 2005), and even later, to other receptors, such as CD147.

The other experimental article omitted is from 2008, and is similar to the previous one, with the difference that it already begins to outline the final optimal amino acids for the RBD of COVID-19, because it defines that an artificial substitution of a Leucine for a Phenylalanine makes the union more solid between the RBD and the hACE2 receptor, and it is precise with a Phenylalanine, as established in that article, that we finally find it, and in the same position, as relative to the RBD of COVID-19; so, as in the article it is an L472F change for the old Sars-CoV-1 (Sheahan et al., 2008), this corresponds to L486F in the case of the new Sars-CoV-2, as the COVID-19 virus is known (linking the name to China).

The importance of these findings is that it is not necessary to invoke a natural cross-linking in a fantastic animal intermediary that seems to be meant to never to be found, as to have obtained the new virus, through trial and error during all of these twenty years or so, that they were already doing tirelessly during that time, the needed work to experimentally obtain the best optimal combination in the real world as it is currently present in COVID-19 (and not necessarily a “theoretical” best).

And apart of these three basic antecedents (2005, 2008, 2015), and that’s not all, as there are more as if when penetrating the rabbit hole of Alice, but for reasons of time, I note an “opinion” piece (Andersen et al., 2020, also from China-controlled Nature, and with endless conflicts of interests, as it happens with all of those “defending” and covering-up against the right kind of research as to track its real origins), which is basically what has deliberately blinded the critical spirit of most scientists, and has been taken as “the consensus”, even though such article doesn’t even solve anything and omits many of the basic and necessary references. That article notes that the RBD of COVID-19 resembles more closely that of a pangolin virus, while the rest of the viral background is of a bat virus. It is this kind of non-granted opinion that has made “people of science” “strive for politics”, instead of looking at the evidence, because: What could have been the intermediary animal inside which the mentioned combination (of the backbone of the virus of the bat, with the precise RBD similar to that of a pangolin virus), and could that have been recombined in such a very punctual and targeted manner? So, the hypothesis without a solution that they pose of a mythological or utopian “beast”, while many lack the critical spirit to do science, consider as if it were the last word but which would require that two different viruses to exchange information in a very precise and targeted way such as that performed in a lab, in the same animal to be true: The bat virus, recombining with the pangolin virus, so that, in an extremely incredible way, exclusively inserting the optimal site of the RBD from a “pangolin”-like virus (18 nucleotides within a total of approximately 29,903 for the complete sequence of the COVID-19, or just a 0.06% of the sequence); as if the pangolin virus had become embedded in a very localized way with no trace in any other place of its genome within the framework of the bat virus. A noncritical belief is required to think in such a way, to be blindly convinced that the pangolin virus was so accurate as to transmit those 6 x 3 sites that are indeed distant or separated within the RBD region, aiming precisely at the proper targets towards the bat virus to optimize those 18 nucleotides at only their precise positions.

To end with these antecedents, I must say that this is not all, although this is what we are made to “believe” in an extremely simplistic way, by most of those who want to end this uncomfortable exploration of the true origins of the virus once and for all. Uncomfortable because legally it would involve China and so many localized factions within the USA, since the financing for the Chinese in Wuhan to continue working with these viruses come in part and during several deliveries, from the North American NIH (Mulraney & Owen, 2020), which sent 3.7 x 2 millions of dollars to Wuhan and more (Morrell, 2020), but this amount pales in comparison to what Gates delivered to “buy” the WHO in 2010 to establish “the decade of the vaccines” or a “Digital” “vaccination,” as he has called it, consisting of 10 billion dollars (Gates Foundation, 2010), being today Gates to the sole biggest financier of the WHO once Trump decided to stop funding it. However, during that time of the year that COVID-19 was released (September 2019), the bats were asleep, hibernating, and no bats are sold in that, blamed first by the CCP with no previous investigation, and now destroyed, Wuhan wet-market and the first three infected with COVID-19 had no contact with that market (Sirotkin & Sirotkin, 2020), plus there has been no transparency at all in any kind of delivery of results. This is now old news because, at this point, even the Chinese CCP acknowledges that there is no evidence that such market did anything at all to modify those sequences, making them lethal to old and sick humans, as the excellent review appeared at the “Bulleting of Atomic Scientists” has just informed us (Leitenberg, 2020). But, I leave it in your hands to explore all of that (if you can find it now that Google is modifying its algorithms to make sure the results of the thousands of serious researchers exploring the lab origin of COVID-19 are harder and harder to find, coupled this to the deletion of all sorts of evidence by China, from notebooks to databases, from actual samples to blocking and international inquiry team other than the WHO). However, since this work is rather molecular, I will be mostly focused on it.


[1] Previously: Molecular Postdoctoral at the Baylor College of Medicine and at the New York Medical College; fdocc@yahoo.com, https://orcid.org/0000-0001-9661-5672, https://bcm.academia.edu/fernandocastrochavez, https://www.researchgate.net/profile/Fernando_Castro-Chavez (v.1 Self-Published in Spanish: Yola, 05/08/2020). The full number is: https://globaljournals.org/GJSFR_Volume20/E-Journal_GJSFR_%28I%29_Vol_20_Issue_3.pdf,  and the final published reference of this article (which has also been submitted to the PubMed of the NIH) is: https://web.archive.org/web/20200811115437/https://globaljournals.org/GJSFR_Volume20/2-Anticovidian-v-2-COVID-19.pdf

Friday-The Aztec Calendar says We’ve Entered the Sixth Sun


The Mayan Calendar date of December 21, 2012 was the beginning of the Sixth Sun according to them. Apparently, the Aztec Calendar which is a bit different than the Mayan said it was May 26, 2021. It feels to me like it’s the END of the Beginning of the Sixth Sun as though this was a transition period between December 21, 2012 and May 26, 2021. It’s been an 8.5 year period or 3078 days. That’s also 109, 28 days Moons. Divided by 20 it’s 153.9. I felt a significant energy shift from Wednesday to Thursday night but the math isn’t exact. One half of a katun is 3600 days.

I pulse in order to Survive. Realizing instinct I seal the Store of Life-Force with the solar tone if INTENTION. I am guided by the power of Birth. I am a galactic activation portal. Enter me.
  • Theme is 9Serine or Red 9 Solar Serpent; Pulsing Life Force, instinct to Survive.
  • Analog is 9Lysine or White 9 Solar Wizard; Realizing Timelessness, receptive to psychic heart knowing that is beyond the intellectual clever mind. It’s HIGH rationality. Rational does not mean WITHOUT feelings. It means incorporating feeling in its natural place
  • Guide Power this morning is 9Cysteine or Red 9 Solar Dragon; realizing our powerful birth into these bodies via our primordial mother. Blood memory is supportive.
  • Antipode this afternoon is 9Arginine or Blue 9 Solar Eagle; Exacting pulse of vision, technically inclined and hopeful. This will be mental acuteness TODAY with Sun and Venus in Gemini and a Moon in Capricorn.
  • Hidden Wisdom is 5Histidine or Yellow 5 Radiant Warrior. This warrior has a knock out punch that is on target. Commanding Intelligence with passion.
  • The 5GForce is 5Arginine or Blue 5 Radiant Eagle pulsing on the antipode today.

How COVID-19 Mutates and Affects Vaccines. They’re using the mRNA because the DNA nucleotide sequence is in it. They can Add Whatever they Want and Not Tell Us.


This is medicine. This is power. You can change and heal yourself.

Before you read the article I’m going to add my piece to it.

They say here that they’re only putting virus DNA into the mRNA template but they CAN add Human DNA into the vaccine as well to mutate us to fit their agenda if they wish. Of course they are denying it. Why would they tell us they’ve been adjusting our DNA all this time through pharma and vaccines to make us more compliant?

The virus alone entering us is safe, the natural way. The human manufactured DNA mutating vaccine is NOT safe because their agenda is not in human’s beings interest and they are capable of adding mutated DNA through the mRNA into it. They keep portraying themselves as altruistic and their track record is the opposite. This is not the time for people to believe what they want to believe to feel comfy. This is the time to use your intuition and observe synchronicity.

Here’s the nutshell (from Lisa); the mRNA (messenger RNA) template is coded by the 3 letter DNA nucleotide, then it goes through transcription and translation into the rRNA which is ribosomal RNA, the sugar backbones of the two DNA strands. The genetic code from the nucleotide is read in the rRNA transcription BEFORE it’s sent to the mysterious, uncontrollable tRNA or transfer RNA created by our ancestors to be CODED BY US, our choices, our feelings, our thoughts and 20% from our parents.

The scientists don’t understand how it works and they can’t control it like can the rigid DNA but the tRNA surrounds the mRNA anyway. That’s why they don’t know what’s going to happen! It’s up to us as a collective to control our tRNA which is done through SYNCHRONCITY with the Tzolkin and our awareness of it.

In my circle of Full Disclosure, I.E.’s and experiencers of off-world species and their planets, it is well known that Earth is a genetic experimental planet. The Urantia Book calls us a decimal planet or experimental station. None of this is sinister from our stellar ancestors perspective but when bad species made contracts with certain humans like the Nazis and royal elite who thought they were special, it did turn sinister. That is where we find ourselves now. They control the sciences and the sick care system.

It is also well known that viruses affect our evolution and always have ever since life was brought here to evolve on Earth. All life is full of mutating and evolving bacteria and viruses and humans are just part of the chain of adapting to that and we’ve done so successfully. The doctors know that and they’ve been muted, ignored or punished for pointing it out. Killing humans (war), nuclear bombing bacteria and viruses with synthetic meds and shots that are meant to help us get stronger and evolve forward is sabotage of friendly stellar ancestors help.

But humans are different in our sentience and held in very high regard by our stellar ancestors. Those making the vaccine and practicing in sick care are not on this side of the information. They view or are programmed to view humans as very deficient and weak and needing invasive intervention. In NO WAY do they acknowledge our potential and our innate super power of Mind, Body and Heart which frankly, J.C. taught and embodied. The elite far, far above them know of our potential and want to check mate it so we can be dumb enough to continue to be their slaves. The institutions that work for the elite are ignorant of the fact that they are not helping but are programmed to disempower not empower the human species.

mRNA is highlighted in this article. It is messenger RNA and has a fairly minor role to play in the mutation of RNA. tRNA or transfer RNA is the adapter between the DNA message and protein. It codes the mRNA from the ribosome. The mRNA finds the start codon on the anti-codon arm which is the Tzolkin antipode, and seeks to mutate the tRNA, which is The 5-amino-acidTzolkin Theme-plex, through Methionine (Red Moon) or UAC nucleotide. It then moves to the T-Arm or the Hidden Wisdom position. There is far, far more to this and it’s in my book. I’m still formatting the electromagnetic charges, + and -, proton and electron per the Tzolkin Harmonic. It’s not difficult, I just have to create the table.

The scientists have no clue about how our protein folds according to our ancient ancestors oracles. None. I’m not sure they’ll even understand my book, which is almost finished. They can’t conceive of the multidimensional nature of our cells. That’s dangerous when you’re messing with mRNA and putting it in an RNA vaccine!! Do they know what they’re doing or are they programmed or contracted with the bad E.T.’s to program it a certain way?

CV2 has been engineered ON PURPOSE by our good stellar ancestors and probably pretty easily given to the humans to disseminate. It’s not an accident. Our elite and our government work with some bad E.T. underground to genetically engineer us and they’ve been doing it forever. That should be part of FULL DISCLOSURE. This particular virus opens and clears out the pineal gland if the host will let it ride. If they don’t, it goes into the lungs and becomes much worse. I meditated on mine to stay in my head and not go into my lungs. I had an intuition it was supposed to and my Spirit Helpers were with me. It was all very odd but I got through it.

We have HELP evolving through meditation, the Earth, and THE SUN. We can deal with and change our own DNA via all of that. I did! It was awesome and I’m grateful. If you’re going to be in a body on this earth you have to help your body evolve and allow it to go into ascension and change. It is not wise to resist it. Viruses are brilliant entities and are meant to help us evolve upward and our immune systems are brilliant at dealing with them. No one except holistic folks and teachers give that information or help. Our society has lied and coddled people so that they think they need invasive help at every turn. That’s the disempowering programming. The article starts below.


Viruses are constantly changing. Their genetic code is prone to changes called mutations that can change how a virus looks or affects its hosts.

“Words like mutation make people think that something terribly wrong is occurring or something is dramatically different,” said Douglas Kasper, MD. Dr. Kasper is the section head of infectious disease at the University of Illinois College of Medicine Peoria and a leader in the OSF HealthCare response to COVID-19.

But often that’s not the case. Viral mutations typically have no significant immediate effect on the ability of the virus to cause disease in humans.

Dr. Kasper explains how viruses mutate and what we know about the new COVID-19 strain first detected in the United Kingdom, South Africa, Brazil and other strains.

How viruses mutate

versions of a coronavirus
abstract technology science concept DNA binary on hi tech blue background

Viruses rely on a host to survive and replicate. They invade the body of a human or an animal and bind with the host’s cells to allow their own genetic material (RNA) to enter the cells. The host’s own cells read the genetic code and replicate it, making more of the virus. That new virus then leaves the cell in search of another host to infect.

Sometimes when that genetic code is being translated into proteins, a piece of the code gets changed. This is called a mutation, and they happen frequently.

“Human cells are DNA-based. And DNA – thankfully for us – has much better integrity than RNA. (THIS IS NOT TRUE. Our RNA is the Fire behind our evolution and has the multidimensional connection that they cannot control. It’s very mutable and jelly like. DNA is rigid, ya know, for the male scientists to play with and do they ever play with it. Yet it’s only 2% of of genome. Our evolving RNA is our superpower and they’re trying to mess with it. The daily changes read through the Tzolkin are all RNA amino acids so you know how we and our relationships change. That eventually changes our DNA)

DNA has the ability to check itself. If there are small changes, or what we call mutations, to its genetic code, it can fix itself and get back to normal. RNA is a lot more messy,” Dr. Kasper said. (Note that word messy. It’s like a woman who has the prerogative to change her mind, like nature. They don’t like it.) (It’s not this cut and dried, at all. There is proof now that we can and do change our DNA by our choices.)

“This perpetual cycle of constant replication goes on. Each time a replication occurs, there is a small chance that code could change. (It’s SUPPOSED to) When you have this go over a huge population over time, the odds start to favor that the virus will adjust. It’s evolution on a very, very rapid level.”

So it’s not surprising that a virus like SARS-CoV-2, the virus that causes COVID-19, would mutate. That’s something scientists and vaccine developers have expected since the beginning of the current epidemic. The question is how drastically and quickly is the virus changing?

Drift vs. shift

“Most of the time when these mutations occur, they are of no consequence, because one adjustment doesn’t change the protein configuration,” Dr. Kasper said. (Now see, this, they don’t know for sure because the protein configuration is exposed to the tRNA and they don’t understand how the tRNA moves or changes.)

These small changes are called “drift,” and usually translate into changes in a protein’s structure that allow our immune systems to continue to recognize and respond to an antigen. What’s more concerning are changes called “shift” – abrupt, major changes in the structure of a virus.

If a virus changes enough, it could be difficult to detect with existing tests, respond differently to treatments and medications or become unrecognizable to the antibodies developed after an infection or vaccination. (Their tests don’t work at all because they don’t know what they’re testing for. That was proven with this virus.)

Scientists around the world are looking closely at a multiple variants of SARS-CoV-2. In the United States, the dominant strain of SARS CoV2 is now B.117. (Adds up to 11. B is 2 + 9 = 11 or Spectral, dissolving, chaotic energy. You know what this is; 11:11)

This variant (B.117) has been found to be more transmissible, meaning infection is more likely to occur in those exposed to the strain, especially those who are unvaccinated. It is not known whether the B.117 variant leads to worse illness or clinical outcomes. Fortunately, the available vaccines provide protection from B.117, making timely vaccination even more of a priority for communities. (Unless you’ve had it and already have the antibodies. People know if they’ve had it. It’s the oddest virus you’ll ever have.)

There are additional variant strains that will be under close watch from worldwide health leaders. The key point remains ensuring that ongoing vaccination provides adequate protection from variant SARS CoV2 strains.

Effectiveness against variant strains

There is reason to believe that the vaccines that have been authorized or are being developed will be able to cover a fair amount of drift in SARS-CoV-2. Vaccine developers are well aware of the ability of viruses to change over time, and they created vaccines that would account for that. (That’s impossible. They just don’t want people to know they don’t know what they’re doing and messing with human RNA-very dangerous)

Because SARS-CoV-2 is part of a large group of coronaviruses, researchers have seen many variations of the spike proteins for which these viruses are named. When developers created vaccines against COVID-19, they tested them against many different variations of the spike protein. (But this one is brand new and different than the others. Fortunately, humans immune systems and consciousness knows how to ADAPT!!!)

Research shows the antibodies created after vaccination will recognize and respond to many variations of the spike protein. This leads experts to be fairly confident the vaccines will continue to be effective against many mutations that may arise. (I’ve heard the opposite. They think we will likely need 2 more versions of the RNA jab.) But they also prepared for how they would respond if a dramatic shift occurs. (Right. We’re supposed to have confidence in them after this debacle. The doctors sure don’t and neither do the therapists dealing with PTSD patients from lockdown which is worse for humans than a virus!!)

“There’s always been an expectation that over time, if these spike proteins do change significantly, the vaccine could be updated to address the changes and still provide the benefit to society that it’s intended to,” Dr. Kasper said.

About the vaccines

The Pfizer and Moderna vaccines both use mRNA to teach our bodies to recognize and fight off these spike proteins. (not good)

While they have multiple ingredients, mRNA vaccines have essentially two important components:

  • mRNA, or a small piece of the virus’s genetic code (the nucleotide and probably some HUMAN DNA as well to keep us docile)
  • A “vessel” of salt, fat and sugar that delivers the mRNA to our cells (the ribosome)

If this structure of the spike protein changed enough that the vaccine’s effectiveness was compromised, it’s likely only that small piece of genetic code would need to be updated – which is much simpler than developing an entirely new vaccine. (This is seriously indolent)

“Part of the reason the mRNA structure was chosen was because of its ability to address these kinds of changes. (because it’s coded by the DNA nucleotides) It was always likely that there would need to be an adjustment,” Dr. Kasper said.

The FDA says the Johnson & Johnson clinical trials showed that its vaccine provided “protection against several emerging SARS-CoV-2 variants of concern,” including the ones from South Africa and Brazil.

For instance, the data that Johnson & Johnson submitted to the FDA showed that in South Africa, where the more contagious B.1.351 strain is dominant, the vaccine was 57% effective at preventing infection.

Johnson & Johnson also is designing software in real time to help respond to some of the new and emerging variants.

About Author: Laura Nightengale

Laura Nightengale was a writing coordinator for OSF HealthCare. 

She has a bachelor’s degree in journalism from the University of Kansas and worked as a reporter at a daily newspaper for five years before joining OSF HealthCare. 

When she’s not working, Laura loves to travel, read, and spend time with her family, including her sweet and ornery dog.

View all posts by Laura Nightengale

Tags: COVID-19infection preventionpopulation health carepreventive medicinevaccinationsviruses

Categories: COVID-19

Friday S.O.-1 Magnetic Valine or Yellow 1 Magnetic Seed


Synchronicity; Note 1:53-2:22 focus on MAGNETISM on this Tone 1 Magnetic day.

Synchronicity at 2:50 forward to cosmic resonances with the Hidden Wisdom; Red 13 Cosmic Earth.

  • Theme; 1 Valine or Yellow 1 Magnetic Seed; Attracting awareness, targeting focus
  • Analog; 1 Arginine or Blue 1 Magnetic Eagle; Vision with purpose, confident, scientific accuracy
  • Guide Power this morning; 1 Valine-ITSELF; unifying potential, leadership, magnetic influencer
  • Antipode this afternoon; 1 Lysine or White 1 Magnetic Wizard-activator or receptive enchantment, psychic aligned with Source, shaman magician
  • Hidden Wisdom at dusk; 13 Phenylalanine or Red 13 Cosmic Earth; Big Synchronicity, sense of direction from within your body and mind
  • 5GForce; 13 Histidine or Yellow 13 Warrior; Cosmic Intelligence, Free-Will Diligence, Bravery
I unify in order to target. Attracting awareness I seal the input of flowering with the magnetic tone of purpose. I am guided by my own power doubled.

Thursday. The solar alignments are in Synchromicity with 13Alanine or Blue 13 Night. S.O. video


We’re at the end of this 13-day cycle on the CA timeline. Blue Night is the 4th archetype.

  • Theme: 13 Alanine or Blue 13 Night; dreaming, intuition, abundance.
  • Analog: 13 Histidine; Yellow 13 Warrior or intelligence, questioning and fearlessness.
  • Guide Power this morning: 13 Isoleucine or Blue 13 Hand; accomplishment, healing and knowing
  • Antipode this afternoon; 13 Glutamine or Red 13 Cosmic Skywalker (me); Exploration, wakefulness and space.
  • Hidden Wisdom at dusk; 1 Tyrosine or White 1 Mirror; reflect order and endlessness
  • 5GForce; 1 Phenylalanine or Red 1 Magnetic Earth (See the S.O. video about the electromagnetism of the earth.

Astrology from Cafe Astrology

  • Venus forms a trine to Pluto this morning, and the need to share or enjoy life on more profound levels dominates.
  • This influence helps us get in touch with what we most love and cherish. We might narrow our focus to our advantage under this influence.
  • We seek to grow, improve, or develop our attachments.
  • Recognizing the value of patience, we’re more strategic, and we’re likely to gain new insight into business and personal relationships. (Saturn mediates theme and analog today)
  • Mercury forms a creative quintile to Neptune (White Mirror is mediated by Neptune) this afternoon, and along with the Pisces Moon, we’re especially idealistic, spiritually aware, and sensitive.
  • These influences encourage us to get in touch with our imaginative, compassionate side.
  • Boundaries dissolve, and we are disinclined to make definite or firm plans, conclusions, and decisions, preferring to allow for possibilities.
  • We might avoid confrontations or challenging situations now. It’s a good time to dream, inspire, and seek inspiration.
I endure in order to dream. Transcending intuition I seal the input of abundance with the cosmic tone of presence. I am guided by the power of accomplishment.

Watson and Crick Were Silenced by the D.S. And Watson Had His Nobel Prize Taken Away for One Comment he Made. All that and Rosalind Franklin’s Photo 51 was Responsible for SHOWING the Double Helix. She was Ignored. The Three Men Won the Nobel Prize.


I wonder if they worked with Operation Paperclip? This link is really something and just brings up more questions for me. Be sure and look at this website and it’s videos and the video below.

https://dnalc.cshl.edu/view/15470-The-moral-responsibility-of-scientists-in-Nazi-Germany-James-Watson.html

I can hardly stand having this on my computer, it’s such bad energy. This is James Watson; founder of our CURRENT science on DNA? Holy Crap. I 100% disagree with him based on what we know now about the Tzolkin and Time and EPIGENETICS. OUR MINDS and OUR CHOICE control our DNA. We ARE equal in our ability to choose. IMO his statement is ignorant, but none of us are 100% correct. Still, something in humans tells us that because we are all Equally loved and cared for by the Universe, we can make a go of it with what we’ve been given and that has NOTHING to do with our Birth Genes.

Francis Crick and James Watson, Molecular Biologists

The Tzolkin Themeplex for the day of discovery of DNA by Watson and Crick; February 28, 1953

8Histidine is the Amino Acid of a Galactic conflict. Still, at least their work was guided by our Sun. But look at the antipode; 8Threonine is death and change. And there is 6Serine, the Reptilians underneath. It’s pretty straight forward. “You would be wise to keep some of what you see under your hat for now.” The Reptilians back in 1953

1-Crick
Francis Crick in his office in his later years. Author: Marc Lieberman
2-Crick
Francis Crick and James Watson

Crick asked himself how it was possible that nature had simultaneously invented two mutually interdependent elements of life: the genetic material –nucleic acids, such as DNA or RNA– and the mechanism necessary to perpetuate it –the proteins called enzymes–.

The synthesis of the nucleic acids depends on the proteins; the amino acids, but the synthesis of the proteins depends on the nucleic acids. Faced with this chicken-and-egg problem, Crick and his colleague Leslie Orgel reasoned that life should have arisen in a place where there exists a “mineral or compound capable of replacing the function of the enzymes, and from there it would have been disseminated to other planets like Earth by “the deliberate activity of an extraterrestrial society.”

The truth is that directed panspermia does not detract from Crick’s thinking at all. Quite the contrary, it reveals the powerful workings of a theoretical, incisive and restless mind, eager for rational answers, even unconventional ones. To understand how Crick came to the idea of panspermia, we must go back a few years. The son of shoemaker Weston Favell (Northampton, UK), Francis Harry Compton Crick (June 8, 1916 – July 28, 2004) reached the end of his childhood with the main aspects of his identity already defined: his penchant for science. As for the first, he chose physics.

Molecular biology might have lost one of its founding fathers had it not been for the war. Crick began his research at University College, London working on what he described as “the dullest problem imaginable” – measuring the viscosity of water at high pressure and temperature. With the outbreak of World War II, he was drafted into the army to work on the design of mines. After the end of the conflict, he discovered that his equipment had been destroyed by a bomb (in his autobiography he spoke of a “land mine”), which allowed him to leave this tedious research.

Crick then had to choose a new field of research, and that was when he discovered what he called the gossip test: “what you are really interested in is what you gossip about.” In his case it was “the borderline between the living and the nonliving, and the workings of the brain,” in a nutshell – biology, or, as a physicist – biophysics. He began working on the structure of proteins in the Cavendish Laboratory of Cambridge, until he met an American named James Watson, twelve years younger than him but already with a PhD that Crick had not yet obtained for himself. Watson & Crick, and their DNA model in the Cavendish Laboratory (1953). Author: Antony Barrington Brown

The two researchers discovered that they shared a hypothesis. At that time it was believed that the seat of inheritance lay in proteins. Crick and Watson thought that genes resided in that unknown substance of the chromosomes, deoxyribonucleic acid (DNA). And that conviction, along with the participation of Maurice Wilkins and Rosalind Franklin, would give birth on February 28, 1953 to one of the greatest discoveries of twentieth century science, the double helix of DNA. The work was published in Nature on April 25 of that year. Crick would not obtain his PhD until the following year.

But although Crick is known primarily for being one of the founders of this milestone of molecular biology, the truth is that he himself laid the first rails of this new science. It was he who proposed that DNA was transcribed to RNA and that this was translated by means of adapter molecules in charge of converting the genetic code for proteins, the building blocks of life. And it was this “central dogma” of biology, as he himself baptized it, which led him to publish in 1973 his hypothesis of panspermia, by then such an elegant idea that it even counted astrophysicist Carl Sagan among its proponents.

Only years later would it be discovered that RNA can act by itself as an enzyme without the intervention of proteins, thus solving the problem that inspired panspermia. In 1993, Crick and Orgel published an article that no longer made any mention of an “extraterrestrial society”.  (Who shook that out of them? Scientists have always been pressured to agree with the Government/Military/D.S. narrative)The chicken-and-egg problem “could be resolved if, early in the evolution of life, nucleic acids acted as catalysts,” they wrote.

By this time Crick had changed continents and fields of study; in 1976 he moved to the Salk Institute in La Jolla (California, USA) for a one year sabbatical that would end up lasting for almost three decades. It was there that he settled his unfinished business with the second of his gossips: the brain. For the rest of his career, and in collaboration with neuroscientist Christof Koch, at the California Institute of Technology (Caltech), he devoted himself to trying to locate consciousness in the brain matter. “You, your joys and your sorrows, your memories and your ambition, your sense of personal identity and free will, are in fact no more than the behavior of a vast assembly of nerve cells and their associated molecules,” he wrote in 1994.

He never managed to unravel the problem of consciousness, although he made significant advances in the knowledge of visual perception. In 2004, he lost his battle against colon cancer, but never lost the courage or the passion for the study of life. According to Christof Koch, “he was editing a manuscript on his death bed, a scientist until the bitter end.”

This is from History.com

They saw Rosalind Franklin’s photo 51 of the DNA that SHOWED the double helix just before their announced their discovery. Her student Wilkins showed it to them but she never learned that he did that. Wilkens then shared in the Nobel Price so it was just the three men and Rosalind was ignored.

On February 28, 1953, Cambridge University scientists James D. Watson and Francis H.C. Crick announced that they have determined the double-helix structure of DNA, the molecule containing human genes. The molecular biologists were aided significantly by the work of another DNA researcher, Rosalind Franklin, although she is not included in the announcement, nor did she share the subsequent Nobel Prize award for it.

Though DNA—short for deoxyribonucleic acid—was discovered in 1869, its crucial role in determining genetic inheritance wasn’t demonstrated until 1943. In the early 1950s, Watson and Crick were only two of many scientists working on figuring out the structure of DNA. California chemist Linus Pauling suggested an incorrect model at the beginning of 1953, prompting Watson and Crick to try and beat Pauling at his own game. 

LISTEN NOW: HISTORY This Week Podcast: The DNA Debate

On the morning of February 28, they determined that the structure of DNA was a double-helix polymer, or a spiral of two DNA strands, each containing a long chain of monomer nucleotides, wound around each other. According to their findings, DNA replicated itself by separating into individual strands, each of which became the template for a new double helix. In his best-selling book, The Double Helix (1968), Watson later claimed that Crick announced the discovery by walking into the nearby Eagle Pub and blurting out that “we had found the secret of life.” The truth wasn’t that far off, as Watson and Crick had solved a fundamental mystery of science–how it was possible for genetic instructions to be held inside organisms and passed from generation to generation.

Watson and Crick’s solution was formally announced on April 25, 1953, following its publication in that month’s issue of Nature magazine. The article revolutionized the study of biology and medicine. Among the developments that followed directly from it were pre-natal screening for disease genes; genetically engineered foods; the ability to identify human remains; the rational design of treatments for diseases such as AIDS; and the accurate testing of physical evidence in order to convict or exonerate criminals.

Crick and Watson later had a falling-out over Watson’s book, which Crick felt misrepresented their collaboration and betrayed their friendship. 

A larger controversy arose over the use Watson and Crick made of work done by another DNA researcher, Rosalind Franklin. Colleague Maurice Wilkins showed Watson and Crick Franklin’s X-ray photographic work to Watson just before he and Crick made their famous discovery. The imagery established that the DNA molecule existed in a helical conformation. When Crick and Watson won the Nobel Prize in 1962, they shared it with Wilkins. Franklin, who died in 1958 of ovarian cancer and was thus ineligible for the award, never learned of the role her photos played in the historic scientific breakthrough.

Citation Information

Article Title

Chemical structure of DNA discovered

Author

History.com Editors

Website Name

HISTORY

URL

https://www.history.com/this-day-in-history/watson-and-crick-discover-chemical-structure-of-dna

Access Date

March 22, 2021

Publisher

A&E Television Networks

Last Updated

March 2, 2021

Original Published Date

November 24, 2009TAGSSCIENCEBY HISTORY.COM EDITORS

© 2021 A&E Television Networks, LLC. All Rights Reserved.

Humans Resist Getting Organized But Feel So Much Better After They Do. It’s like Working Out.


Today is Red 6 Rhythmic Moon. Can you organize your feelings instead of acting on them?

What most people do is eat or drink alcohol more when they don’t want to deal with organizing their feelings. My “go to” lately are frozen yogurt bars. In the past it was bingey potato chips. Humans are addicted to feelings so avoid them. I believe Huey Lewis sang about being “addicted to love” but he meant the sexy, lusty, emotional kind, not the real kind.

The Moon has entered Sagittarius which the Virgo Sun forms a square to this afternoon during Blue 6 Storm. This could create some tension unless you know how to ignore pettiness and gossip.

Big minds discuss ideas, mediocre minds discuss events and small minds talk about people.

Eleanor Roosevelt

That sizes up our media in a nutshell. I guess that’s why I’m annoying. All I want to talk about is ideas and it stresses people out. My big idea with this blog is there is far more to our DNA and who we are in time and in our families than anyone realizes. I’m scoping out facts and research and then adding my intuition to the mix. One would think that would be valuable to a whole lot of people but most of them are busy reacting to what everyone else does or worse, following what everyone else does.

The Theme is Red 6 Moon, Analog is White 6 Dog, Guide Power is itself, Antipode is Blue 6 Storm and Hidden Wisdom is Yellow 6 Human so Mercury, Pluto opposing and Earth are strong players astrologically from the UNIVERSAL perspective, not the astrological perspective.Red Moon and White Dog are mediated by Mercury so the good part is a Mercury-Uranus trine opens us to creative ideas. The 5GForce is Blue 8 Monkey or galactic creativity, playfulness and illusion. It actually comes up as the Gateway in two days. The galactic tone is all about integrity and doing what you say you’re going to do. That creates harmony and a good example for others.

There is definitely a creative restlessness in the astrology and in The larger Matrix. Channeled well, these aspects encourage us to improve but otherwise might lead to over-indulgence, lack of moderation, or exaggeration. We need to be in touch with our feelings so we can moderate our expectations of ourselves and others.

Methionine is the start codon for the mRNA sequence and tryptophan sometimes functions as a stop codon so this could be a defining day or a type of test to see if we’re taking control of our vibe. Look at the similarity between White Dog and Yellow Human. Yellow Human just has the extra COOH molecule.

The tryptophan molecule with the presence of the hexagon and the pentagon is indicative of the influence of Jupiter and Saturn in holding our DNA together in the past. Now that that’s over I wonder if it will be replaced with something else or rehabilitated?

Saturday; Blue 9 Solar Storm


We know all about solar storms these days. There have been very, very strong ones from our Sun that have been affecting everything and everybody on earth in the last few months or so. Nothing on the sun is normal anymore and Earth is intimately tied to it since the Earth was born out of the Sun. Think of the Sun as our father and the Dark of space within which ALL resides as our mother. They are local universe parents.

In addition, The Schumann resonance has been off the charts. The Schumann resonances (SR) are a set of spectrum peaks in the extremely low frequency (ELF) portion of the Earth’s electromagnetic field spectrum. Schumann resonances are global electromagnetic resonances, generated and excited by lightning discharges in the cavity formed by the Earth’s surface and the ionosphere. They are known to affect the human body.

The cause of all of this is it’s time for earth to evolve forward, to take an evolutionary jump and activate our light body at a steady pace and join the universal stream. This is nothing new. Earth, viruses, bacteria, all plant life and rocks, animals, you name it have been evolving for GOOD PURPOSE now for billions of years. Humans are supposed to be part of the natural order and accept it. It’s not acceptable for Earth and humans to become artificial intelligence which has wreaked havoc in other parts of our universe. It’s not going to happen here. It’s only when our eyes and hearts close that we want to control others and have everything for themselves or have it our way. That’s done too.

The 5GForce is Red 5 Dragon of Radiant Blood Mother and Birth. It’s heavy energy that is bringing the power of feminine back to earth.

Today is Blue 9 Storm, Analog is Yellow 9 Sun, Guide Power is Blue 9 Eagle, Antipode is Red 9 Moon, and Hidden Wisdom is White 5 Wind

The body uses tryptophan to help make niacin, melatonin, and serotonin. Serotonin is thought to produce healthy sleep and a stable mood. In order for tryptophan in the diet to be changed into niacin, the body needs to have enough iron.

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that. I agree with social distancing but not the masks. Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA