Quantum Coherence and the Hidden Secret Behind Our Bodies – SAND

When I say our cells are quantum, BEFORE I read any of the science, I’m spot on based on 23 years of empirical experience working on patients in my office, at least 23,000 of them. I have to live with barely any human understanding or support for my work and writing but I came to the planet to help humans uplift, not be popular, although it might help spread the word. Scientists are now just beginning to talk about this but I’ve experienced it for 23 years, not to mention 32 years of tracking synchronicity in the Tzolkin.

I appreciate my followers support and wish it would grow to be in the thousands. Maybe we’re just getting started.- Time is DNA

When the human genome was sequenced, some scientists were saying, “That’s the end. We’re going to understand every disease. We’re going to understand every behavior.” And it turns out, we didn’t, because the sequence of the DNA isn’t enough to explain behavior. It isn’t enough to explain diseases.”

Denise Chow, LiveScience: Why Your DNA May Not Be Your Destiny

(Your Tzolkin destiny oracle is evolving tRNA, not DNA only from your family so in that perspective she is correct)

In a commentary on the surprising results of the Human Genome Project, David Baltimore, one of the world’s preeminent geneticists and a Nobel Prize winner, addressed the issue of human complexity: “But unless the human genome contains a lot of genes that are opaque to our computers, it is clear that we do not gain our undoubted complexity over worms and plants by using more genes.”

David Baltimore

Not finding the preprogramming for all of life encoded in our genes has forced geneticists into a fundamental reassessment of how our genes function. This reassessment has been strongly influenced by relatively recent discoveries that have led to the establishment of a new discipline in genetics known as epigenetics—literally, “above the gene.” These discoveries indicate that our genes are not fixed—that what were previously considered permanently dormant genes can become active and active genes can become deactivated.

https://www.scienceandnonduality.com/article/quantum-coherence-and-the-hidden-secret-behind-our-bodies

The first stages of DNA evolution. This is Brand New Information.

DNA glyco protein Amino acids that make our flesh and blood are made from everything that came before us…150 different molecules from the Sun and planets; Stardust..and it’s sentience.

We have found that dew droplets of acidic water in a primordial CO2 atmosphere could enhance the replication of DNA molecules.”

Alan Ianeselli, Ph.D. student and first author of the research

“The first stages of DNA evolution” https://phys.org/news/2022-03-stages-dna-evolution.amp

Anti-Covid19 v.2

This was originally posted August 26, 2020. Dr. Chavez told me he felt his life was threatened around this time. As of November 21, 2022 I have not heard from him. He had a stroke and asked for me help with looking up treatment which I did. I have not heard from him. It caused blindness. I am very suspicious about what caused his stroke. Dr. Chavez saw my work before I published and was complimentary but probably like many scientists, doesn’t fully understand it yet.

I’ve been in Messenger with Dr. Chavez. I needed to delete my last post by him because he feels his life is threatened. (I JUST SAW THIS! OCT. 27 2021.) There are more details I will not disclose. But I have been allowed to post portions of this paper. It’s 62 pages long and this is just the first 7 pages. Dr. Chavez is a PhD molecular biologist who has studied the CV2 sequence extensively.

I may post another section tomorrow Enjoy! Lisa

COVID-19: Hypothesis of the Lab Origin versus a Zoonotic Event Which Can Also be of a Lab Origin

By Dr,Fernando Castro-Chavez.[1]

Abstract:

To treat the cause of a disease and not only its effects are of the utmost importance; hence, we need to know the origin of this pandemic of COVID-19, to be able, if possible, to prevent an event of such a nature and magnitude in the future, and to be able to avoid all sorts of abuses to humanity, as is happening right now. Bullet points here addressed are:

1) To have, inside the backbone of a virus from a bat (mostly ~97.55% of the viral RNA (by deducting the HIV inserts found by Perez, Montagnier and others), & as per the findings of Petrovsky, see below, and also to contrast the differences), the insertion similar to that of a pangolin virus for the Receptor Binding Domain (RBD, which basically consists of six separated key amino acids, or the 0.06% of its genome for these particular 18 nucleotides), being their receptor the ACE2 of the human lung, appearing at a time (as earlier as since September of 2019), where there were already mature all of the molecular methodologies necessary to modify individual nucleotides (Crispr-Cas9, “Seamless”, etc.) that then modify at will the resulting amino acids, with the possibility to give an extra passage to the virus through ferrets (or other lab animals) that have an ACE2 very similar to the humans, to give it then a more “natural” appearance (by random trivial changes); because, had it been natural, this could had required an animal host infected with these two viruses simultaneously, and that with an unexplainable marksmanship, to specifically modify the key six codons (and a second independent of such impossible recombinants, to give raise to the differences exclusively present at the end of the long Orf1ab, into the Nsf15 and Nsf16);

2) To have an even more important and unique peculiar site, PRRAR (encompassing the needed 12 bases to complete that sequence, being this the 0.04% of the full genome), for protease cleavage (new to Plasmin and Furin, plus Trypsin, TMRPSS2, etc.) inside the protein called Spike (S), to obtain the fragments S1 and S2 to allow the viral RNA to penetrate the cell (expanding the range, not only to lung cells as the previous modification but also to white and neural cells), whose nucleotides producing it are highly strange to the rest of the viral sequence, because they contain more than an 83% of richness in its nucleotides GC, being these 12 nucleotides alien to the rest of the virus: CCUCGGCGGGCA (similar to bacterial and to methodological sequences patented by Moderna, Inc., cleavable by restriction enzymes BsaJI, AciI, Cac8I, MnlI…), that are engrained to the three remaining bases: CGU present in the frame of the bat virus to complete the necessary sequence. This will require, either a third virus completely unknown until now, either in the same utopian animal described before, or through a second passage of the first chimera into another animal, and then that such viral beast, could also be able to target exclusively this region, and no other site whatsoever; then, it is explored,

3) The biggest shot in variation, when it is compared to the first sequence obtained of the virus of COVID-19, with its immediate ancestor, that according to Shi Zheng-Li is the RaTG13 (submitted a posteriori of the COVID-19 first sequence, and which researchers demonstrate that this is a partially made-up sequence (see below), having her deliberately ignored even to cite her previous identical reference called BtCoV/4991 (2016), or even her most recent reference of the same that she put under the name of SARSr-CoV Ra4991 (2019), being very dishonest for her to change in at least three identified times the names of her same sequence, actions that render her highly suspicious, because she hid the rest of the sequence at least during the last four year (having been obtained from excrement in a cave, she says. After a call due to a serious case of miners infected at Yunnan. Nobody knows what was inside at least six miners), but her publishing it until now, after the emergence of a similar virus, makes her highly suspicious, rather than making her look innocent. Who can say that she did not manipulate as well artificially such sequence, or that the CCP Chinese military did not do the same to the other two previous sequences that are also somehow similar to Sars-CoV-2?

How many more hundreds of sequences will they be hiding? Nobody independently has been able to verify the accuracy of their claims. Everything is based only on what they say. Given that the nucleotides of six proteins exhibit a 99% of similitude between both sequences, while twelve of them go down to a 96% or even are below of this number, being the most extreme changes, the ones that are inside the sequence for the protein Spike, which while exhibiting a global similitude of 93%, is the one having the highest discrepancy between the two sequences.

Within this same one there are extreme shorter variations, with a low similitude of 44% on that specific of the RBD mentioned before, which goes down to some 17% for the region of those 18 key bases. Only 20% percent for that sequence of 12 bases for the resulting protease cleavage site; other changes include the optimal nucleotides of an even shorter region of 16 segments similar to immunodeficiency genes (plus two more distant ones). Even a couple of concatenated Plasmodium yoelii found by Perez and Montagnier at the S2 place, all that could be better explained with artificial processes already in place to do this and more within the frame of the awful Gain-of-Function sinister and dual-purpose (or double-talk) research.

So, it is their word against the world, and that is why since at least 2010 I have been proposing an independent verification by at least three other labs of results reported, especially by CCP Chinese researchers, as they did cost me already my first job in the US by their lying during at least ten years about a methodological artifact that I called “Palindromati”, and that they kept on reporting as “natural” while receiving grants to explore a chimera.

How much more is it costing their apparent lying about the artificial origin of COVID-19 at this time?) So, all of these points and so much more, because Jesse Morrell, for example, is reaching a set of almost 40 (and counting) pieces of evidence of a lab origin versus cero. Otherwise, things and persons that are leading us to conclude that it is evident to see that there was human intervention in the emergence of this Sars-CoV-2 virus because in 2015-2018 there was not in existence any zoonotic history of any class in Wuhan, so, this virus, having been originated already mature and fully capable to attack the human population, implies an artificial “injecting” source.

“…have no fellowship with the unfruitful works of DARKNESS, but rather expose them. For it is shameful even to speak of those things which are done by THEM in secret. But all things that are exposed are made manifest by the LIGHT…” An inspired Paul in Eph. 5:11-13.

Dedicated to Francis S. Collins for the many to be able to see…

Introduction:

A balanced set of voices is needed in this COVID-19 Pandemic, and such is the purpose of this work, to speak the pros and the cons of every claim. I also want to make this presentation a personal one, as scientists tend to simulate isolation of themselves from their research. But in the end, they are still as human as anybody else and their personal bias and experiences always show up.

So, here we will be just another lonely human. Especially within this Pandemic that has tended to “dehumanize” humanity. So, here I am, back to the simplicity of what is meant to be “human” and with feelings.

Three pieces of evidence in science are normally required to establish something as evident (Crombie, 1994). In this case, we will see three minimum reasons, and one more to give a certain range of tolerance (plus another at the beginning, aimed at those with eyes to see), and this will be the determining factor in identifying if COVID-19 is artificial or otherwise, which will show prominently to the reader that this COVID-19 virus is of a human design. Currently, there are zero shreds of evidence in favor of the opposite view.

I hope that other scientists, especially all those honest virologists, immunologists, immunologists, epidemiologists, molecular biologists, human physicians (excluding those “inhumane”), veterinarians, etc., etc., are also doing this kind of vital work, as it is to “define the origin” of this COVID-19 pandemic, which is mainly devastating morally the people of this planet (humans against humans), and needless to say, devastating the infected victims (from all of those tainted statistics that we are all aware of).

It is necessary to know the truth to prevent something like this from happening again, and to prevent a recurrence in the course of the current pandemic, as there is still the slightest chance that more of the same pathogens will continue to be released with the purpose of “escalating” such crisis, which by all accounts has been designed globally, but with the final target of the USA. The fact that an official denial appears in all articles related to the human engineering of COVID-19, saying that: “There is no evidence of it”, indeed speaks volumes about a deliberate attempt to silence the truth, as well as does the unrequested invasion of our privacy by the WHO in all social platform available on the internet, and the censorship by the same WHO under higher orders, of every posting or video that does not agree with the narrative that they pretend to impose over the whole of the human race.

Here, I present then, this minimal evidence that shows just the opposite: That “there is evidence” indeed of a lab-leak, and even further, of an even engineered virus as the most plausible explanation of the current malady, as if planned. This is presented for the free evaluation of the reader.

This work is also an attempt to respond to the most recent question posed in Nature, talking about the WIV of Zheng-Li Shi: “The lab does hold coronaviruses related to SARS-CoV-2, so it is possible that one could have escaped, perhaps if a lab worker accidentally became infected from a virus sample or animal in the facility and then passed it on to someone outside the facility. It is also theoretically possible that scientists at the lab tweaked the virus’s genome for research purposes before it escaped, but, again, there is no evidence that they did. Shi declined to respond to Nature’s questions about her experiments, saying that she has been inundated with media requests” (Cyranoski. 2020) So, Shi, the main suspect in this story is declining to explain her research, however, in what she has published thus far there is vast evidence that COVID-19 may have been designed there at the WIV, the evidence available for anybody willing to dig into her publications. This article wishes to help a little on that aspect.

Antecedents:

Most recently, before the release of his second article on the subject, Birger Sørensen declared: “I think it’s more than 90 percent certain. It’s at least a far more probable explanation than it having developed this way in nature” (https://archive.vn/Wmj9p), where he also explains that the adulterations go beyond the attachment to the human ACE2 receptor (shown in my first point) and, it is within that spirit that I present my current work. So, I name this study “Anticovidian v.2” because it is in line with my previous collective research into Antiobesity (Castro-Chavez et al., 2003) and Antiatherosclerosis (Castro-Chavez et al., 2013), where I also demonstrated, as I hope to do here, that a contaminating laboratory artifact had intruded on thousands of sequences present in the Genbank and even in the Affimetrix Microarrays (Castro-Chavez, 2012). In this viral case, a most basic antecedent I would like to emphasize as many have done, and this is the article by Baric & Zhengli (Zheng-Li) from 2015 (Menachery et al., 2015), published within the time in which Obama had advised a moratorium for such studies, moratorium which lasted in the US from 2014 to 2017, and in the end, it was when, Obama before leaving office indicated its reactivation until the ban was finally lifted by Francis S. Collins (Morrell, 2020). However, in disregard of that ban, these authors managed to continuously publish their work, which again aroused an ethical conflict during that year (Akst, 2015), and as they continued doing Gain-of-Function research non-stop in Wuhan at UNC.

The experiment they carried out was to develop a super-coronavirus that was capable of killing elderly mice, a result that they do not present, as it would be expected, in the main text, but rather in a compound figure in their supplement (Fig. 3b), in which the complete death of elderly mice is observed on the fourth day (Menachery et al., 2015). In a recent interview with Baric, it was indicated that this murderous virus was “found”, but the truth is that he, with Zheng-Li and one peer, plus his team, “designed” it, but did not “find” it as it was deceivingly reported on 2020: https://www.wral.com/unc-researcher-found-deadly-virus-in-bats-in-china-in-2015/18913313/ (whose headline has been saved at https://archive.vn/DI2mT). But, just from the onset, you can start seeing that there is the desire by the seriously conflicted actors, for all of this to remain hidden or changed.

Remarkable in this Menachery et al. (2015) work is that two of the authors came from Wuhan, where the COVID-19 pandemic broke out, and that they are credited with having brought both the necessary plasmids, as well as the murderous version of the modified gene “Spike”, a key protein for viral entry into the human cells, and that Baric just now deposited its sequence MT308984: https://archive.vn/P5ay7

Now, it has been discovered that a handwritten version exists before the final version of this 2015 article by Baric for the journal Nature Medicine (now under Chinese control), and it was the first version format to be published by the NIH PubMed; what is noticeable about this previous version, is that it has two more and key methodological references that are not present in the final electronic version (Menachery et al., 2015). Art Bobroff, through Facebook, indicates that the removal of those two key methodological references is a standard procedure in GoF research, to comply with the “law” about this kind of risky research; it may be so, but indeed those references are very telling.

The first is from 2005 and shows that the Spike protein site called the Receptor Binding Domain (RBD), was also very well known, focusing since then as well, only on the six key amino-acid contacts within the so-called then RBM, Receptor Binding Motif, currently known generically as RBD mostly due to Andersen et al. (2020), whose work has been multiple times debunked, such as in Stout (2020, thanks to Rubio for the reference), which is responsible for the attachment of the virus to the receptor of the lung cells called the ACE2; in addition, since then, the state of the underground molecular art allowed already something like single nucleotide changes to be made on individual nucleotides (already known, but later made into a CRISPR/Cas9-deaminase methodology: Shevidi et al. 2017), which in turn would modify the resulting amino acid, and in such article, its authors focus on modifying the key amino acids necessary to improve the RBD binding to the ACE2 (Qu et al., 2005), and even later, to other receptors, such as CD147.

The other experimental article omitted is from 2008, and is similar to the previous one, with the difference that it already begins to outline the final optimal amino acids for the RBD of COVID-19, because it defines that an artificial substitution of a Leucine for a Phenylalanine makes the union more solid between the RBD and the hACE2 receptor, and it is precise with a Phenylalanine, as established in that article, that we finally find it, and in the same position, as relative to the RBD of COVID-19; so, as in the article it is an L472F change for the old Sars-CoV-1 (Sheahan et al., 2008), this corresponds to L486F in the case of the new Sars-CoV-2, as the COVID-19 virus is known (linking the name to China).

The importance of these findings is that it is not necessary to invoke a natural cross-linking in a fantastic animal intermediary that seems to be meant to never to be found, as to have obtained the new virus, through trial and error during all of these twenty years or so, that they were already doing tirelessly during that time, the needed work to experimentally obtain the best optimal combination in the real world as it is currently present in COVID-19 (and not necessarily a “theoretical” best).

And apart of these three basic antecedents (2005, 2008, 2015), and that’s not all, as there are more as if when penetrating the rabbit hole of Alice, but for reasons of time, I note an “opinion” piece (Andersen et al., 2020, also from China-controlled Nature, and with endless conflicts of interests, as it happens with all of those “defending” and covering-up against the right kind of research as to track its real origins), which is basically what has deliberately blinded the critical spirit of most scientists, and has been taken as “the consensus”, even though such article doesn’t even solve anything and omits many of the basic and necessary references. That article notes that the RBD of COVID-19 resembles more closely that of a pangolin virus, while the rest of the viral background is of a bat virus. It is this kind of non-granted opinion that has made “people of science” “strive for politics”, instead of looking at the evidence, because: What could have been the intermediary animal inside which the mentioned combination (of the backbone of the virus of the bat, with the precise RBD similar to that of a pangolin virus), and could that have been recombined in such a very punctual and targeted manner? So, the hypothesis without a solution that they pose of a mythological or utopian “beast”, while many lack the critical spirit to do science, consider as if it were the last word but which would require that two different viruses to exchange information in a very precise and targeted way such as that performed in a lab, in the same animal to be true: The bat virus, recombining with the pangolin virus, so that, in an extremely incredible way, exclusively inserting the optimal site of the RBD from a “pangolin”-like virus (18 nucleotides within a total of approximately 29,903 for the complete sequence of the COVID-19, or just a 0.06% of the sequence); as if the pangolin virus had become embedded in a very localized way with no trace in any other place of its genome within the framework of the bat virus. A noncritical belief is required to think in such a way, to be blindly convinced that the pangolin virus was so accurate as to transmit those 6 x 3 sites that are indeed distant or separated within the RBD region, aiming precisely at the proper targets towards the bat virus to optimize those 18 nucleotides at only their precise positions.

To end with these antecedents, I must say that this is not all, although this is what we are made to “believe” in an extremely simplistic way, by most of those who want to end this uncomfortable exploration of the true origins of the virus once and for all. Uncomfortable because legally it would involve China and so many localized factions within the USA, since the financing for the Chinese in Wuhan to continue working with these viruses come in part and during several deliveries, from the North American NIH (Mulraney & Owen, 2020), which sent 3.7 x 2 millions of dollars to Wuhan and more (Morrell, 2020), but this amount pales in comparison to what Gates delivered to “buy” the WHO in 2010 to establish “the decade of the vaccines” or a “Digital” “vaccination,” as he has called it, consisting of 10 billion dollars (Gates Foundation, 2010), being today Gates to the sole biggest financier of the WHO once Trump decided to stop funding it. However, during that time of the year that COVID-19 was released (September 2019), the bats were asleep, hibernating, and no bats are sold in that, blamed first by the CCP with no previous investigation, and now destroyed, Wuhan wet-market and the first three infected with COVID-19 had no contact with that market (Sirotkin & Sirotkin, 2020), plus there has been no transparency at all in any kind of delivery of results. This is now old news because, at this point, even the Chinese CCP acknowledges that there is no evidence that such market did anything at all to modify those sequences, making them lethal to old and sick humans, as the excellent review appeared at the “Bulleting of Atomic Scientists” has just informed us (Leitenberg, 2020). But, I leave it in your hands to explore all of that (if you can find it now that Google is modifying its algorithms to make sure the results of the thousands of serious researchers exploring the lab origin of COVID-19 are harder and harder to find, coupled this to the deletion of all sorts of evidence by China, from notebooks to databases, from actual samples to blocking and international inquiry team other than the WHO). However, since this work is rather molecular, I will be mostly focused on it.


[1] Previously: Molecular Postdoctoral at the Baylor College of Medicine and at the New York Medical College; fdocc@yahoo.com, https://orcid.org/0000-0001-9661-5672, https://bcm.academia.edu/fernandocastrochavez, https://www.researchgate.net/profile/Fernando_Castro-Chavez (v.1 Self-Published in Spanish: Yola, 05/08/2020). The full number is: https://globaljournals.org/GJSFR_Volume20/E-Journal_GJSFR_%28I%29_Vol_20_Issue_3.pdf,  and the final published reference of this article (which has also been submitted to the PubMed of the NIH) is: https://web.archive.org/web/20200811115437/https://globaljournals.org/GJSFR_Volume20/2-Anticovidian-v-2-COVID-19.pdf

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon

This post is from August 2020.

Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.

Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

Dr. Chavez Brand New Data on Lab Analysis of the Covid19 Sequence. It’s Not Natural, Therefore a Real Vaccine Cannot be Made

I posted this July 23, 2020, a year and a half ago.

For the record, Dr. Chavez validates the work I’m doing in Time Science. He is a molecular biologist and works with DNA in the lab.

abstract technology science concept DNA binary on hi tech blue background
Fernando Castro-Chavez is with Lambert Dolphin.

9 hours ago

Whatever They Make and Market is  Either Culling or a Placebo. It’s Not Medicine.

Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.

As you skim, please be sure to read the highlighted areas.-Lisa T.

My posting of today at the Research Gate: “By Sørensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical etiology of the SARS-CoV-2 Spike

https://www.minervanett.no/…/13/TheEvidenceNoNaturalEvol.pdf,

This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.

The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte

SARS-CoV-2 is possessed of dual action capability

Simultaneously it is capable of binding to ACE2 receptors

The likelihood of this being the result of natural processes is very small.”

The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”

A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”

Why does this matter?”

“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”

the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved

“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”

“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”

“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”

“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”

“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”

“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”

“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”

“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”

“a designed mutated strain (initially) lacking the furin cleavage site residues was used”

“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”

“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:

1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!

“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”

“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”

“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”

“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!

“typically the objective of gain of function experiments… a strong indicator of manipulation”

“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”

“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!

Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”

“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”

“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.

“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…

“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!

“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!

“we now add here a forensic analysis”!!!!

Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:

“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”

“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”

“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”

Note:

So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!

But the fight continues as follows:

“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”

And the next one is a “classic” of infamy:

“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”

“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.

“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”

“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”

“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”

“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.

“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”

“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.

So, “the reconstructed historical etiology of the Spike (is) as follows:”

“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”

Conclusion
“We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”

Additionally, in this wretched document;

 https://apps.who.int/…/annual_re…/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/…/annual…/GPMB_annualreport_2019.pdf ),

We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”

Anti-Covid19 v.2

I’ve been in Messenger with Dr. Chavez. I needed to delete my last post by him because he feels his life is threatened. I JUST SAW THIS! OCT. 27 2021. There are more details I will not disclose. But I have been allowed to post portions of this paper. It’s 62 pages long and this is just the first 7 pages. Dr. Chavez is a PhD molecular biologist who has studied the CV2 sequence extensively.

I may post another section tomorrow Enjoy! Lisa

COVID-19: Hypothesis of the Lab Origin versus a Zoonotic Event Which Can Also be of a Lab Origin

By Dr,Fernando Castro-Chavez.[1]

Abstract:

To treat the cause of a disease and not only its effects are of the utmost importance; hence, we need to know the origin of this pandemic of COVID-19, to be able, if possible, to prevent an event of such a nature and magnitude in the future, and to be able to avoid all sorts of abuses to humanity, as is happening right now. Bullet points here addressed are:

1) To have, inside the backbone of a virus from a bat (mostly ~97.55% of the viral RNA (by deducting the HIV inserts found by Perez, Montagnier and others), & as per the findings of Petrovsky, see below, and also to contrast the differences), the insertion similar to that of a pangolin virus for the Receptor Binding Domain (RBD, which basically consists of six separated key amino acids, or the 0.06% of its genome for these particular 18 nucleotides), being their receptor the ACE2 of the human lung, appearing at a time (as earlier as since September of 2019), were there were already mature all of the molecular methodologies necessary to modify individual nucleotides (Crispr-Cas9, “Seamless”, etc.) that then modify at will the resulting amino acids, with the possibility to give an extra passage to the virus through ferrets (or other lab animals) that have an ACE2 very similar to the humans, to give it then a more “natural” appearance (by random trivial changes); because, had it been natural, this could had required an animal host infected with these two viruses simultaneously, and that with an unexplainable marksmanship, to specifically modify the key six codons (and a second independent of such impossible recombinants, to give raise to the differences exclusively present at the end of the long Orf1ab, into the Nsf15 and Nsf16);

2) To have an even more important and unique peculiar site, PRRAR (encompassing the needed 12 bases to complete that sequence, being this the 0.04% of the full genome), for protease cleavage (new to Plasmin and Furin, plus Trypsin, TMRPSS2, etc.) inside the protein called Spike (S), to obtain the fragments S1 and S2 to allow the viral RNA to penetrate the cell (expanding the range, not only to lung cells as the previous modification but also to white and neural cells), whose nucleotides producing it are highly strange to the rest of the viral sequence, because they contain more than an 83% of richness in its nucleotides GC, being these 12 nucleotides alien to the rest of the virus: CCUCGGCGGGCA (similar to bacterial and to methodological sequences patented by Moderna, Inc., cleavable by restriction enzymes BsaJI, AciI, Cac8I, MnlI…), that are engrained to the three remaining bases: CGU present in the frame of the bat virus to complete the necessary sequence. This will require, either a third virus completely unknown until now, either in the same utopian animal described before, or through a second passage of the first chimera into another animal, and then that such viral beast, could also be able to target exclusively this region, and no other site whatsoever; then, it is explored,

3) The biggest shot in variation, when it is compared to the first sequence obtained of the virus of COVID-19, with its immediate ancestor, that according to Shi Zheng-Li is the RaTG13 (submitted a posteriori of the COVID-19 first sequence, and which researchers demonstrate that this is a partially made-up sequence (see below), having her deliberately ignored even to cite her previous identical reference called BtCoV/4991 (2016), or even her most recent reference of the same that she put under the name of SARSr-CoV Ra4991 (2019), being very dishonest for her to change in at least three identified times the names of her same sequence, actions that render her highly suspicious, because she hid the rest of the sequence at least during the last four year (having been obtained from excrement in a cave, she says, after a call due to a serious case of miners infected at Yunnan, and nobody knows still what was inside those at least six miners), but her publishing it until now, after the emergence of a similar virus, makes her highly suspicious, rather than making her look innocent; and, who can say that she did not manipulate as well artificially such sequence, or that the CCP Chinese military did not do the same to the other two previous sequences that are also somehow similar to Sars-CoV-2?, and how many more hundreds of sequences will they be hiding?, because nobody independently has been able to verify the accuracy of their claims, being everything based only in what they say), given that the nucleotides of six proteins exhibit a 99% of similitude between both sequences, while twelve of them go down to a 96% or even are below of this number, being the most extreme changes, the ones that are inside the sequence for the protein Spike, which while exhibiting a global similitude of 93%, is the one having the highest discrepancy between the two sequences, and within this same one there are extreme shorter variations, with a low similitude of 44% on that specific of the RBD mentioned before, which goes down to some 17% for the region of those 18 key bases, and of only the 20% percent for that sequence of 12 bases for the resulting protease cleavage site; other changes include the optimal nucleotides of an even shorter region of 16 segments similar to immunodeficiency genes (plus two more distant ones), and even a couple of concatenated Plasmodium yoelii found by Perez and Montagnier at the S2 place, all that could be better explained with artificial processes already in place to do this and more within the frame of the awful Gain-of-Function sinister and dual-purpose (or double-talk) research. So, it is their word against the world, and that is why since at least 2010 I have been proposing an independent verification by at least three other labs of results reported, especially by CCP Chinese researchers, as they did cost me already my first job in the US by their lying during at least ten years about a methodological artifact that I called “Palindromati”, and that they kept on reporting as “natural” while receiving grants to explore a chimera, and how more is it costing their apparent lying about the artificial origin of COVID-19 at this time?) So, all of these points and so much more, because Jesse Morrell, for example, is reaching a set of almost 40 (and counting) pieces of evidence of a lab origin versus cero otherwise, things and persons that are leading us to conclude that it is evident to see that there was human intervention in the emergence of this Sars-CoV-2 virus because in 2015-2018 there was not in existence any zoonotic history of any class in Wuhan, so, having been originated this virus already mature and fully capable to attack the human population, implies an artificial “injecting” source.

“…have no fellowship with the unfruitful works of DARKNESS, but rather expose them. For it is shameful even to speak of those things which are done by THEM in secret. But all things that are exposed are made manifest by the LIGHT…” An inspired Paul inEph. 5:11-13.

Dedicated to Francis S. Collins, so as for the many to be able to see…

Introduction:

A balanced set of voices is needed in this COVID-19 Pandemic, and such is the purpose of this work, to speak the pros and the cons of every claim. I also want to make this presentation a personal one, as scientists tend to simulate isolation of themselves from their research. But in the end, they are still as human as anybody else and their personal bias and experiences always show up. So, here we will be just another lonely human. Especially within this Pandemic that has tended to “dehumanize” humanity. So, here am I, back to the simplicity of what is meant to be “human” and with feelings. Three pieces of evidence in science are normally required to establish something as evident (Crombie, 1994). In this case, we will see three minimum reasons, and one more to give a certain range of tolerance (plus another at the beginning, aimed at those with eyes to see), and this will be the determining factor in identifying if COVID-19 is artificial or otherwise, which will show prominently to the reader that this COVID-19 virus is of a human design. Currently, there are zero shreds of evidence in favor of the opposite view.

I hope that other scientists, especially all those honest virologists, immunologists, infectiologists, epidemiologists, molecular biologists, human physicians (excluding those “inhuman”), veterinarians, etc., etc., are also doing this kind of vital work, as it is to “Define the origin” of this COVID-19 pandemic, which is mainly devastating morally the people of this planet (humans against humans), and needless to say, devastating the infected victims (from all of those tainted statistics that we are all aware of).

It is necessary to know the truth to prevent something like this from happening again, and to prevent a recurrence in the course of the current pandemic, as there is still the slightest chance that more of the same pathogens will continue to be released with the purpose of “escalating” such crisis, which by all accounts has been designed globally, but with the final target of the USA. The fact that an official denial appears in all articles related to the human engineering of COVID-19, saying that: “There is no evidence of it”, indeed speaks volumes about a deliberate attempt to silence the truth, as well as does the unrequested invasion of our privacy by the WHO in all social platform available on the internet, and the censorship by the same WHO under higher orders, of every posting or video that does not agree with the narrative that they pretend to impose over the whole of the human race.

Here, I present then, this minimal evidence that shows just the opposite: That “there is evidence” indeed of a lab-leak, and even further, of an even engineered virus as the most plausible explanation of the current malady, as if planned. This is presented for the free evaluation of the reader.

This work is also an attempt to respond to the most recent question posed in Nature, talking about the WIV of Zheng-Li Shi: “The lab does hold coronaviruses related to SARS-CoV-2, so it is possible that one could have escaped, perhaps if a lab worker accidentally became infected from a virus sample or animal in the facility and then passed it on to someone outside the facility. It is also theoretically possible that scientists at the lab tweaked the virus’s genome for research purposes before it escaped, but, again, there is no evidence that they did. Shi declined to respond to Nature’s questions about her experiments, saying that she has been inundated with media requests” (Cyranoski. 2020) So, Shi, the main suspect in this story is declining to explain her research, however, in what she has published thus far there is vast evidence that COVID-19 may have been designed there at the WIV, the evidence available for anybody willing to dig into her publications. This article wishes to help a little on that aspect.

Antecedents:

Most recently, before the release of his second article on the subject, Birger Sørensen declared: “I think it’s more than 90 percent certain. It’s at least a far more probable explanation than it having developed this way in nature” (https://archive.vn/Wmj9p), where he also explains that the adulterations go beyond the attachment to the human ACE2 receptor (shown in my first point) and, it is within that spirit that I present my current work. So, I name this study “Anticovidian v.2” because it is in line with my previous collective research into Antiobesity (Castro-Chavez et al., 2003) and Antiatherosclerosis (Castro-Chavez et al., 2013), where I also demonstrated, as I hope to do here, that a contaminating laboratory artifact had intruded on thousands of sequences present in the Genbank and even in the Affimetrix Microarrays (Castro-Chavez, 2012). In this viral case, a most basic antecedent I would like to emphasize as many have done, and this is the article by Baric & Zhengli (Zheng-Li) from 2015 (Menachery et al., 2015), published within the time in which Obama had advised a moratorium for such studies, moratorium which lasted in the US from 2014 to 2017, and in the end, it was when, Obama before leaving office indicated its reactivation until the ban was finally lifted by Francis S. Collins (Morrell, 2020). However, in disregard of that ban, these authors managed to continuously publish their work, which again aroused an ethical conflict during that year (Akst, 2015), and as they continued doing Gain-of-Function research non-stop in Wuhan at UNC.

The experiment they carried out was to develop a super-coronavirus that was capable of killing elderly mice, a result that they do not present, as it would be expected, in the main text, but rather in a compound figure in their supplement (Fig. 3b), in which the complete death of elderly mice is observed on the fourth day (Menachery et al., 2015). In a recent interview with Baric, it was indicated that this murderous virus was “found”, but the truth is that he, with Zheng-Li and one peer, plus his team, “designed” it, but did not “find” it as it was deceivingly reported on 2020: https://www.wral.com/unc-researcher-found-deadly-virus-in-bats-in-china-in-2015/18913313/ (whose headline has been saved at https://archive.vn/DI2mT). But, just from the onset, you can start seeing that there is the desire by the seriously conflicted actors, for all of this to remain hidden or changed.

Remarkable in this Menachery et al. (2015) work is that two of the authors came from Wuhan, where the COVID-19 pandemic broke out, and that they are credited with having brought both the necessary plasmids, as well as the murderous version of the modified gene “Spike”, a key protein for viral entry into the human cells, and that Baric just now deposited its sequence MT308984: https://archive.vn/P5ay7

Now, it has been discovered that a handwritten version exists before the final version of this 2015 article by Baric for the journal Nature Medicine (now under Chinese control), and it was the first version format to be published by the NIH PubMed; what is noticeable about this previous version, is that it has two more and key methodological references that are not present in the final electronic version (Menachery et al., 2015). Art Bobroff, through Facebook, indicates that the removal of those two key methodological references is a standard procedure in GoF research, to comply with the “law” about this kind of risky research; it may be so, but indeed those references are very telling.

The first is from 2005 and shows that the Spike protein site called the Receptor Binding Domain (RBD), was also very well known, focusing since then as well, only on the six key amino-acid contacts within the so-called then RBM, Receptor Binding Motif, currently known generically as RBD mostly due to Andersen et al. (2020), whose work has been multiple times debunked, such as in Stout (2020, thanks to Rubio for the reference), which is responsible for the attachment of the virus to the receptor of the lung cells called the ACE2; in addition, since then, the state of the underground molecular art allowed already something like single nucleotide changes to be made on individual nucleotides (already known, but later made into a CRISPR/Cas9-deaminase methodology: Shevidi et al. 2017), which in turn would modify the resulting amino acid, and in such article, its authors focus on modifying the key amino acids necessary to improve the RBD binding to the ACE2 (Qu et al., 2005), and even later, to other receptors, such as CD147.

The other experimental article omitted is from 2008, and is similar to the previous one, with the difference that it already begins to outline the final optimal amino acids for the RBD of COVID-19, because it defines that an artificial substitution of a Leucine for a Phenylalanine makes the union more solid between the RBD and the hACE2 receptor, and it is precise with a Phenylalanine, as established in that article, that we finally find it, and in the same position, as relative to the RBD of COVID-19; so, as in the article it is an L472F change for the old Sars-CoV-1 (Sheahan et al., 2008), this corresponds to L486F in the case of the new Sars-CoV-2, as the COVID-19 virus is known (linking the name to China).

The importance of these findings is that it is not necessary to invoke a natural cross-linking in a fantastic animal intermediary that seems to be meant to never to be found, as to have obtained the new virus, through trial and error during all of these twenty years or so, that they were already doing tirelessly during that time, the needed work to experimentally obtain the best optimal combination in the real world as it is currently present in COVID-19 (and not necessarily a “theoretical” best).

And apart of these three basic antecedents (2005, 2008, 2015), and that’s not all, as there are more as if when penetrating the rabbit hole of Alice, but for reasons of time, I note an “opinion” piece (Andersen et al., 2020, also from China-controlled Nature, and with endless conflicts of interests, as it happens with all of those “defending” and covering-up against the right kind of research as to track its real origins), which is basically what has deliberately blinded the critical spirit of most scientists, and has been taken as “the consensus”, even though such article doesn’t even solve anything and omits many of the basic and necessary references. That article notes that the RBD of COVID-19 resembles more closely that of a pangolin virus, while the rest of the viral background is of a bat virus. It is this kind of non-granted opinion that has made “people of science” “strive for politics”, instead of looking at the evidence, because: What could have been the intermediary animal inside which the mentioned combination (of the backbone of the virus of the bat, with the precise RBD similar to that of a pangolin virus), and could that have been recombined in such a very punctual and targeted manner? So, the hypothesis without a solution that they pose of a mythological or utopian “beast”, while many lack the critical spirit to do science, consider as if it were the last word but which would require that two different viruses to exchange information in a very precise and targeted way such as that performed in a lab, in the same animal to be true: The bat virus, recombining with the pangolin virus, so that, in an extremely incredible way, exclusively inserting the optimal site of the RBD from a “pangolin”-like virus (18 nucleotides within a total of approximately 29,903 for the complete sequence of the COVID-19, or just a 0.06% of the sequence); as if the pangolin virus had become embedded in a very localized way with no trace in any other place of its genome within the framework of the bat virus. A noncritical belief is required to think in such a way, to be blindly convinced that the pangolin virus was so accurate as to transmit those 6 x 3 sites that are indeed distant or separated within the RBD region, aiming precisely at the proper targets towards the bat virus to optimize those 18 nucleotides at only their precise positions.

To end with these antecedents, I must say that this is not all, although this is what we are made to “believe” in an extremely simplistic way, by most of those who want to end this uncomfortable exploration of the true origins of the virus once and for all. Uncomfortable because legally it would involve China and so many localized factions within the USA, since the financing for the Chinese in Wuhan to continue working with these viruses come in part and during several deliveries, from the North American NIH (Mulraney & Owen, 2020), which sent 3.7 x 2 millions of dollars to Wuhan and more (Morrell, 2020), but this amount pales in comparison to what Gates delivered to “buy” the WHO in 2010 to establish “the decade of the vaccines” or a “Digital” “vaccination,” as he has called it, consisting of 10 billion dollars (Gates Foundation, 2010), being today Gates to the sole biggest financier of the WHO once Trump decided to stop funding it. However, during that time of the year that COVID-19 was released (September 2019), the bats were asleep, hibernating, and no bats are sold in that, blamed first by the CCP with no previous investigation, and now destroyed, Wuhan wet-market and the first three infected with COVID-19 had no contact with that market (Sirotkin & Sirotkin, 2020), plus there has been no transparency at all in any kind of delivery of results. This is now old news because, at this point, even the Chinese CCP acknowledges that there is no evidence that such market did anything at all to modify those sequences, making them lethal to old and sick humans, as the excellent review appeared at the “Bulleting of Atomic Scientists” has just informed us (Leitenberg, 2020). But, I leave it in your hands to explore all of that (if you can find it now that Google is modifying its algorithms to make sure the results of the thousands of serious researchers exploring the lab origin of COVID-19 are harder and harder to find, coupled this to the deletion of all sorts of evidence by China, from notebooks to databases, from actual samples to blocking and international inquiry team other than the WHO). However, since this work is rather molecular, I will be mostly focused on it.


[1] Previously: Molecular Postdoctoral at the Baylor College of Medicine and at the New York Medical College; fdocc@yahoo.com, https://orcid.org/0000-0001-9661-5672, https://bcm.academia.edu/fernandocastrochavez, https://www.researchgate.net/profile/Fernando_Castro-Chavez (v.1 Self-Published in Spanish: Yola, 05/08/2020). The full number is: https://globaljournals.org/GJSFR_Volume20/E-Journal_GJSFR_%28I%29_Vol_20_Issue_3.pdf,  and the final published reference of this article (which has also been submitted to the PubMed of the NIH) is: https://web.archive.org/web/20200811115437/https://globaljournals.org/GJSFR_Volume20/2-Anticovidian-v-2-COVID-19.pdf

How COVID-19 Mutates and Affects Vaccines. They’re using the mRNA because the DNA nucleotide sequence is in it. They can Add Whatever they Want and Not Tell Us.

This is medicine. This is power. You can change and heal yourself.

Before you read the article I’m going to add my piece to it.

They say here that they’re only putting virus DNA into the mRNA template but they CAN add Human DNA into the vaccine as well to mutate us to fit their agenda if they wish. Of course they are denying it. Why would they tell us they’ve been adjusting our DNA all this time through pharma and vaccines to make us more compliant?

The virus alone entering us is safe, the natural way. The human manufactured DNA mutating vaccine is NOT safe because their agenda is not in human’s beings interest and they are capable of adding mutated DNA through the mRNA into it. They keep portraying themselves as altruistic and their track record is the opposite. This is not the time for people to believe what they want to believe to feel comfy. This is the time to use your intuition and observe synchronicity.

Here’s the nutshell (from Lisa); the mRNA (messenger RNA) template is coded by the 3 letter DNA nucleotide, then it goes through transcription and translation into the rRNA which is ribosomal RNA, the sugar backbones of the two DNA strands. The genetic code from the nucleotide is read in the rRNA transcription BEFORE it’s sent to the mysterious, uncontrollable tRNA or transfer RNA created by our ancestors to be CODED BY US, our choices, our feelings, our thoughts and 20% from our parents.

The scientists don’t understand how it works and they can’t control it like can the rigid DNA but the tRNA surrounds the mRNA anyway. That’s why they don’t know what’s going to happen! It’s up to us as a collective to control our tRNA which is done through SYNCHRONCITY with the Tzolkin and our awareness of it.

In my circle of Full Disclosure, I.E.’s and experiencers of off-world species and their planets, it is well known that Earth is a genetic experimental planet. The Urantia Book calls us a decimal planet or experimental station. None of this is sinister from our stellar ancestors perspective but when bad species made contracts with certain humans like the Nazis and royal elite who thought they were special, it did turn sinister. That is where we find ourselves now. They control the sciences and the sick care system.

It is also well known that viruses affect our evolution and always have ever since life was brought here to evolve on Earth. All life is full of mutating and evolving bacteria and viruses and humans are just part of the chain of adapting to that and we’ve done so successfully. The doctors know that and they’ve been muted, ignored or punished for pointing it out. Killing humans (war), nuclear bombing bacteria and viruses with synthetic meds and shots that are meant to help us get stronger and evolve forward is sabotage of friendly stellar ancestors help.

But humans are different in our sentience and held in very high regard by our stellar ancestors. Those making the vaccine and practicing in sick care are not on this side of the information. They view or are programmed to view humans as very deficient and weak and needing invasive intervention. In NO WAY do they acknowledge our potential and our innate super power of Mind, Body and Heart which frankly, J.C. taught and embodied. The elite far, far above them know of our potential and want to check mate it so we can be dumb enough to continue to be their slaves. The institutions that work for the elite are ignorant of the fact that they are not helping but are programmed to disempower not empower the human species.

mRNA is highlighted in this article. It is messenger RNA and has a fairly minor role to play in the mutation of RNA. tRNA or transfer RNA is the adapter between the DNA message and protein. It codes the mRNA from the ribosome. The mRNA finds the start codon on the anti-codon arm which is the Tzolkin antipode, and seeks to mutate the tRNA, which is The 5-amino-acidTzolkin Theme-plex, through Methionine (Red Moon) or UAC nucleotide. It then moves to the T-Arm or the Hidden Wisdom position. There is far, far more to this and it’s in my book. I’m still formatting the electromagnetic charges, + and -, proton and electron per the Tzolkin Harmonic. It’s not difficult, I just have to create the table.

The scientists have no clue about how our protein folds according to our ancient ancestors oracles. None. I’m not sure they’ll even understand my book, which is almost finished. They can’t conceive of the multidimensional nature of our cells. That’s dangerous when you’re messing with mRNA and putting it in an RNA vaccine!! Do they know what they’re doing or are they programmed or contracted with the bad E.T.’s to program it a certain way?

CV2 has been engineered ON PURPOSE by our good stellar ancestors and probably pretty easily given to the humans to disseminate. It’s not an accident. Our elite and our government work with some bad E.T. underground to genetically engineer us and they’ve been doing it forever. That should be part of FULL DISCLOSURE. This particular virus opens and clears out the pineal gland if the host will let it ride. If they don’t, it goes into the lungs and becomes much worse. I meditated on mine to stay in my head and not go into my lungs. I had an intuition it was supposed to and my Spirit Helpers were with me. It was all very odd but I got through it.

We have HELP evolving through meditation, the Earth, and THE SUN. We can deal with and change our own DNA via all of that. I did! It was awesome and I’m grateful. If you’re going to be in a body on this earth you have to help your body evolve and allow it to go into ascension and change. It is not wise to resist it. Viruses are brilliant entities and are meant to help us evolve upward and our immune systems are brilliant at dealing with them. No one except holistic folks and teachers give that information or help. Our society has lied and coddled people so that they think they need invasive help at every turn. That’s the disempowering programming. The article starts below.


Viruses are constantly changing. Their genetic code is prone to changes called mutations that can change how a virus looks or affects its hosts.

“Words like mutation make people think that something terribly wrong is occurring or something is dramatically different,” said Douglas Kasper, MD. Dr. Kasper is the section head of infectious disease at the University of Illinois College of Medicine Peoria and a leader in the OSF HealthCare response to COVID-19.

But often that’s not the case. Viral mutations typically have no significant immediate effect on the ability of the virus to cause disease in humans.

Dr. Kasper explains how viruses mutate and what we know about the new COVID-19 strain first detected in the United Kingdom, South Africa, Brazil and other strains.

How viruses mutate

versions of a coronavirus
abstract technology science concept DNA binary on hi tech blue background

Viruses rely on a host to survive and replicate. They invade the body of a human or an animal and bind with the host’s cells to allow their own genetic material (RNA) to enter the cells. The host’s own cells read the genetic code and replicate it, making more of the virus. That new virus then leaves the cell in search of another host to infect.

Sometimes when that genetic code is being translated into proteins, a piece of the code gets changed. This is called a mutation, and they happen frequently.

“Human cells are DNA-based. And DNA – thankfully for us – has much better integrity than RNA. (THIS IS NOT TRUE. Our RNA is the Fire behind our evolution and has the multidimensional connection that they cannot control. It’s very mutable and jelly like. DNA is rigid, ya know, for the male scientists to play with and do they ever play with it. Yet it’s only 2% of of genome. Our evolving RNA is our superpower and they’re trying to mess with it. The daily changes read through the Tzolkin are all RNA amino acids so you know how we and our relationships change. That eventually changes our DNA)

DNA has the ability to check itself. If there are small changes, or what we call mutations, to its genetic code, it can fix itself and get back to normal. RNA is a lot more messy,” Dr. Kasper said. (Note that word messy. It’s like a woman who has the prerogative to change her mind, like nature. They don’t like it.) (It’s not this cut and dried, at all. There is proof now that we can and do change our DNA by our choices.)

“This perpetual cycle of constant replication goes on. Each time a replication occurs, there is a small chance that code could change. (It’s SUPPOSED to) When you have this go over a huge population over time, the odds start to favor that the virus will adjust. It’s evolution on a very, very rapid level.”

So it’s not surprising that a virus like SARS-CoV-2, the virus that causes COVID-19, would mutate. That’s something scientists and vaccine developers have expected since the beginning of the current epidemic. The question is how drastically and quickly is the virus changing?

Drift vs. shift

“Most of the time when these mutations occur, they are of no consequence, because one adjustment doesn’t change the protein configuration,” Dr. Kasper said. (Now see, this, they don’t know for sure because the protein configuration is exposed to the tRNA and they don’t understand how the tRNA moves or changes.)

These small changes are called “drift,” and usually translate into changes in a protein’s structure that allow our immune systems to continue to recognize and respond to an antigen. What’s more concerning are changes called “shift” – abrupt, major changes in the structure of a virus.

If a virus changes enough, it could be difficult to detect with existing tests, respond differently to treatments and medications or become unrecognizable to the antibodies developed after an infection or vaccination. (Their tests don’t work at all because they don’t know what they’re testing for. That was proven with this virus.)

Scientists around the world are looking closely at a multiple variants of SARS-CoV-2. In the United States, the dominant strain of SARS CoV2 is now B.117. (Adds up to 11. B is 2 + 9 = 11 or Spectral, dissolving, chaotic energy. You know what this is; 11:11)

This variant (B.117) has been found to be more transmissible, meaning infection is more likely to occur in those exposed to the strain, especially those who are unvaccinated. It is not known whether the B.117 variant leads to worse illness or clinical outcomes. Fortunately, the available vaccines provide protection from B.117, making timely vaccination even more of a priority for communities. (Unless you’ve had it and already have the antibodies. People know if they’ve had it. It’s the oddest virus you’ll ever have.)

There are additional variant strains that will be under close watch from worldwide health leaders. The key point remains ensuring that ongoing vaccination provides adequate protection from variant SARS CoV2 strains.

Effectiveness against variant strains

There is reason to believe that the vaccines that have been authorized or are being developed will be able to cover a fair amount of drift in SARS-CoV-2. Vaccine developers are well aware of the ability of viruses to change over time, and they created vaccines that would account for that. (That’s impossible. They just don’t want people to know they don’t know what they’re doing and messing with human RNA-very dangerous)

Because SARS-CoV-2 is part of a large group of coronaviruses, researchers have seen many variations of the spike proteins for which these viruses are named. When developers created vaccines against COVID-19, they tested them against many different variations of the spike protein. (But this one is brand new and different than the others. Fortunately, humans immune systems and consciousness knows how to ADAPT!!!)

Research shows the antibodies created after vaccination will recognize and respond to many variations of the spike protein. This leads experts to be fairly confident the vaccines will continue to be effective against many mutations that may arise. (I’ve heard the opposite. They think we will likely need 2 more versions of the RNA jab.) But they also prepared for how they would respond if a dramatic shift occurs. (Right. We’re supposed to have confidence in them after this debacle. The doctors sure don’t and neither do the therapists dealing with PTSD patients from lockdown which is worse for humans than a virus!!)

“There’s always been an expectation that over time, if these spike proteins do change significantly, the vaccine could be updated to address the changes and still provide the benefit to society that it’s intended to,” Dr. Kasper said.

About the vaccines

The Pfizer and Moderna vaccines both use mRNA to teach our bodies to recognize and fight off these spike proteins. (not good)

While they have multiple ingredients, mRNA vaccines have essentially two important components:

  • mRNA, or a small piece of the virus’s genetic code (the nucleotide and probably some HUMAN DNA as well to keep us docile)
  • A “vessel” of salt, fat and sugar that delivers the mRNA to our cells (the ribosome)

If this structure of the spike protein changed enough that the vaccine’s effectiveness was compromised, it’s likely only that small piece of genetic code would need to be updated – which is much simpler than developing an entirely new vaccine. (This is seriously indolent)

“Part of the reason the mRNA structure was chosen was because of its ability to address these kinds of changes. (because it’s coded by the DNA nucleotides) It was always likely that there would need to be an adjustment,” Dr. Kasper said.

The FDA says the Johnson & Johnson clinical trials showed that its vaccine provided “protection against several emerging SARS-CoV-2 variants of concern,” including the ones from South Africa and Brazil.

For instance, the data that Johnson & Johnson submitted to the FDA showed that in South Africa, where the more contagious B.1.351 strain is dominant, the vaccine was 57% effective at preventing infection.

Johnson & Johnson also is designing software in real time to help respond to some of the new and emerging variants.

About Author: Laura Nightengale

Laura Nightengale was a writing coordinator for OSF HealthCare. 

She has a bachelor’s degree in journalism from the University of Kansas and worked as a reporter at a daily newspaper for five years before joining OSF HealthCare. 

When she’s not working, Laura loves to travel, read, and spend time with her family, including her sweet and ornery dog.

View all posts by Laura Nightengale

Tags: COVID-19infection preventionpopulation health carepreventive medicinevaccinationsviruses

Categories: COVID-19

Friday S.O.-1 Magnetic Valine or Yellow 1 Magnetic Seed

Synchronicity; Note 1:53-2:22 focus on MAGNETISM on this Tone 1 Magnetic day.

Synchronicity at 2:50 forward to cosmic resonances with the Hidden Wisdom; Red 13 Cosmic Earth.

  • Theme; 1 Valine or Yellow 1 Magnetic Seed; Attracting awareness, targeting focus
  • Analog; 1 Arginine or Blue 1 Magnetic Eagle; Vision with purpose, confident, scientific accuracy
  • Guide Power this morning; 1 Valine-ITSELF; unifying potential, leadership, magnetic influencer
  • Antipode this afternoon; 1 Lysine or White 1 Magnetic Wizard-activator or receptive enchantment, psychic aligned with Source, shaman magician
  • Hidden Wisdom at dusk; 13 Phenylalanine or Red 13 Cosmic Earth; Big Synchronicity, sense of direction from within your body and mind
  • 5GForce; 13 Histidine or Yellow 13 Warrior; Cosmic Intelligence, Free-Will Diligence, Bravery
I unify in order to target. Attracting awareness I seal the input of flowering with the magnetic tone of purpose. I am guided by my own power doubled.

Thursday Daily Oracle; The solar alignments are in Synchronicity with 13Alanine or Blue 13 Night. S.O. video

We’re at the end of this 13-day cycle on the CA timeline. Blue Night is the 4th archetype.

I endure in order to dream. Transcending intuition I seal the input of abundance with the cosmic tone of presence. I am guided by the power of accomplishment.
  • Theme: 13 Alanine or Blue 13 Night; dreaming, intuition, abundance.
  • Analog: 13 Histidine; Yellow 13 Warrior or intelligence, questioning and fearlessness.
  • Guide Power this morning: 13 Isoleucine or Blue 13 Hand; accomplishment, healing and knowing
  • Antipode this afternoon; 13 Glutamine or Red 13 Cosmic Skywalker (me); Exploration, wakefulness and space.
  • Hidden Wisdom at dusk; 1 Tyrosine or White 1 Mirror; reflect order and endlessness
  • 5GForce; 1 Phenylalanine or Red 1 Magnetic Earth (See the S.O. video about the electromagnetism of the earth.

Astrology from Cafe Astrology

  • Venus forms a trine to Pluto this morning, and the need to share or enjoy life on more profound levels dominates.
  • This influence helps us get in touch with what we most love and cherish. We might narrow our focus to our advantage under this influence.
  • We seek to grow, improve, or develop our attachments.
  • Recognizing the value of patience, we’re more strategic, and we’re likely to gain new insight into business and personal relationships. (Saturn mediates theme and analog today)
  • Mercury forms a creative quintile to Neptune (White Mirror is mediated by Neptune) this afternoon, and along with the Pisces Moon, we’re especially idealistic, spiritually aware, and sensitive.
  • These influences encourage us to get in touch with our imaginative, compassionate side.
  • Boundaries dissolve, and we are disinclined to make definite or firm plans, conclusions, and decisions, preferring to allow for possibilities.
  • We might avoid confrontations or challenging situations now. It’s a good time to dream, inspire, and seek inspiration.

%d bloggers like this: