Tweet from Edward Snowden (@Snowden)


Edward Snowden (@Snowden) Tweeted: Amazon announces Spyware-as-a-Service: https://t.co/6hkzsHjxh9 https://twitter.com/Snowden/status/1305883597262520325?s=20

What’s Happening on Saturn? A Transcribed Interview of David Wilcock, Author


Deep Space Saturn-David Wilcock.

“Saturn’s rings changed in one day within minutes. We saw electromagnetic vehicles in there. The plasma exhaust from the vehicle was changing the rings. There’s something called “the thing in the ring”. It’s been spotted by NASA and there are photographs recording it and it is giving off radio signals.

The thing in the ring on Saturn

There are ancient accounts that Saturn is a broadcasting system of fantastic power. A picture of a ring of Saturn taken from a certain angle is frequency sound. The rings are sound frequency. Saturn’s rings can sing! Since the rings are composed of trillions of icy particles all in orbit around the giant planet we can apply the same pitch scaling that we used for the moons to the entire ring system. It’s having a massive impact on human senses and the human sense of reality.

These broadcasts from Saturn are at the southern pole.There is a storm that looks just like an eye and at the northern pole that is the hexagon storm where clouds are whipping around at an enormous speed. How do you get what should be gas clouds rotating freely turning into a hexagon? We’re talking about straight lines and a series of angles in a very symmetrical shape. That should never exist at the North Pole of Saturn. There isn’t really any basis in physics, geophysics, or planetary physics to explain why you would have this tunnel of clouds that would make a sharp turn and form a hexagon.

The Hexagonal Storm on the North Pole of Saturn

It’s what Hans Jenny discovered; that he could take a drop of water and have these free-floating particles of sand in it called colloids, and that is called a colloidal suspension, and if you have the water with a colloidal suspension normally it’s just going to look milky however once Dr. Jenny started to vibrate the water with diatonic sound frequencies; the white keys on the piano, then all of a sudden those sand particles would mysteriously make geometric patterns. These patterns included square, diamond, triangular, hexagonal shapes just like we see on the North Pole of Saturn as well as in certain cases even pentagonal symmetry which does not occur in normal crystal formation.

This is a very strange Enigma of Science and when we look at it there is a very consistent thread of scholarship suggesting that geometry is the foundation of the universe.When we look at ancient Tibetan and Hindu mandalas they show what appears to be matrices of geometry as the key to unlocking the mysteries of the universe. There are also undoubtedly so many reports of anecdotal people having psychedelic experiences and seeing geometric patterns while they are in that state of consciousness. It was happening to me as a little kid when I would get these fevers and my temperature would go well over a hundred degrees and suddenly everything around me would look like it was made from geometry.

So, I have looked at this problem in geometry for a very long time and my conclusion is that planets are in fact gating through hyperdimensional energy.This was something that was originally discovered by Lieutenant Colonel Tom Bearden and was then picked up by Richard C. Hoagland in his classic book “The Monuments of Mars.” We can look at certain examples in our solar system and see this type of geometry appearing in the way these planets look.

Hyperdimensional physics

Everything in this universe receives energy from a higher level of dimension. There are complicated mathematical equations done by topologists, (in mathematics, topology is concerned with the properties of a geometric object that are preserved under continuous deformations, such as stretching, twisting, crumpling, and bending, but not tearing or gluing) that describe these higher special dimensions and what they might look like. It also explains why it’s shaped like a hexagon.

Maybe Saturn is a gateway for that incoming energy.My answer to why the 19.5 degrees has the swirling activity is that just like in Hans Jenny’s experiments, when you vibrate that water, those particles of sand appear geometrically or anywhere else in the water. So, in the same way, you’re going to get the greatest amount of motion and the greatest amount of swirling in the areas where the geometry is in all the clouds around. In a solid plain it is going to swirl around under the crust with then break up through and create a volcano-like vortex as we see at 19.5 latitude. So, you have visible atmospheric or crustal phenomena and you have a portal effect.

So now let’s look back at Saturn to see what the heck is going on here. We have an undeniable hexagonal shape in the northern hemisphere that even skeptical scientists now have to admit is a functional characteristic of fluid dynamics behavior. That’s not even being disputed anymore. Fluid Dynamics is in fact the only acceptable answer for how this geometry could be there. Richard Hoagland talked about how the up-welling point was 19.5 degrees give or take a planetary body, and is a spinning body like the Earth versus on Earth, there is the Mauna Loa volcano which is the highest volcano on Earth. At 19.5 degrees you have the Great Red Spot on Jupiter which is 19.5 degrees which has to do with the geometry of a circumscribed tetrahedron.

The storms on Saturn have been going for well over thirty years and they have not dissipated, they have not changed and something is driving it. There is no conventional explanation in physics that could account for it. The classic example of course is the vortex that would be at 19.5 degrees north or south of the Equator and Hoagland went through this extensively.The most obvious example we have is the Great Red Spot 19.5 degrees south of stable consistent gigantic hurricane that you can fit five-planet earth into side by side ever since the dawn of the invention of the telescope in the 1600’s that we know of, probably a lot longer, and it’s just spinning and spinning.

We also see a dark spot on Neptune and it’s at the same latitude where we see the sunspots on the sun. They always tend to be in these bands at 19.5 North and 19.5 South and really nowhere else.

This new image taken with the NASA/ESA Hubble Space Telescope confirms the presence of a dark vortex in the atmosphere of Neptune. The full visible-light image at left shows that the dark feature resides near and below a patch of bright clouds in the planet’s southern hemisphere. The dark spot measures roughly 4,800 kilometers across. Other high-altitude clouds can be seen at the planet’s equatorial region and polar regions. The image at right shows that Neptune’s dark vortices are typically best seen at blue wavelengths. Only Hubble has the high resolution required for identifying such weather features on distant Neptune. Though similar features were seen during the Voyager 2 flyby of Neptune in 1989 and by Hubble in 1994, this vortex is the first one observed on the planet in the 21st century. In September 2015, the Outer Planet Atmospheres Legacy (OPAL) program, a long-term Hubble Space Telescope project that annually captures global maps of the outer planets, revealed a dark spot close to the location of the bright clouds, which had been tracked from the ground. By viewing the vortex a second time, the new Hubble images, taken by Wide Field Camera 3 on May 16, 2016, confirm that OPAL really detected a long-lived feature. With the new data, the team created a higher-quality map of the vortex and its surroundings. Links: NASA Press release Neptune (full color) Image with dark spot (blue light) Scale and compass image for dark spot on Neptune Neptune (full color) Full color Neptune global map from Hubble’s OPAL program (dark spot and companion clouds closeup) Blue Light Neptune Global Map from Hubble’s OPAL Program (Dark Spot Closeup)

Also, when we look at solid planets like Earth or Mars where they have a crust, we see huge volcanoes that appear at this latitude and they only seem to be the largest that latitude. For example, on Mars, the biggest volcano is twice the height of Mount Everest and is called Olympus Mons which exists right at 19.5. Then if you go one tetrahedral turn off you have the face of Sedona on Mars. Its 120 degrees away in longitude so it would definitely appear that there is some sort of multidimensional energy going on that is causing this to happen.Now the theory gets more interesting when we look at what has happened with the Earth because Dr. Ivan T Sanderson investigated the Bermuda Triangle phenomena. That was then picked up by Charles Berlitz who took one of the vortexes and wrote the classic book “Bermuda Triangle”

.But it is not just the rings or the odd geometry that makes Saturn so enigmatic as NASA’s Cassini Mission showed. Some of the moons of Saturn are also a puzzle waiting to be solved. Saturn’s moons are about as weird as it gets. Similar to a whole bunch of these moons, they might actually have liquid water below their visible surfaces. This is really interesting because when you have water you usually have life.

Iapetus seems like an artificial body and it had all the characteristics you would expect of an artificial body orbiting at about a 60-degree angle which is kind of the horizon that is shaved geometrically. It does not have a spherically curved wind but has a very distinct set of equally long lines on the horizon. Some people argue that it’s a dodecahedron. In addition to that, there’s this ring around it that makes Iapetus look like a walnut. The fascinating thing about that is it’s right around on the equator itself. It’s right where you would put it if you were manufacturing the Death Star.

It’s important also to remember that if you actually read the book by Arthur C Clarke 2001 that the planet that Commander David Goldman goes to with HAL was Saturn, not Jupiter. And then Stanley Kubrick was the one who wanted to change it to Jupiter for visual purposes. For creative purposes, he was worried about getting the rings right all that kind of stuff but then we have some very strange things around Saturn like the moon Iapetus. It’s black on one side and white on the other and that was a key part of our Arthur C. Clark’s book as well. Iapetus was the gateway that led to whatever this portal was around Saturn.

We’re looking at people tipping us off on this idea that the portal phenomenon may exist. The question of whether Iapetus is still occupied as wide-open nobody really knows. It appears to be abandoned and certainly logically, we would assume has been there for millions and millions of years so it seems doubtful to me that it would be occupied. But who knows? Who knows where ET bases are in the solar system and who knows who built it was it built by human hands? ET hands are people like us; humanoids that built an environment for themselves on Saturn.

The question is why would you build so far away from Earth in the inner solar system where you’ve got a lot more life teeming. It is interesting to note that NASA is sending the Cassini space probe into Saturn knowing that it has seventy-two pounds of plutonium on board. This is something that they have tried to do before in the furthest parts of the solar system. We’ve heard it from multiple insiders. They want to take a radioactive, essentially a nuclear bomb, and then plunge it into the hydrogen laced atmosphere of a planet like Jupiter or a planet like Saturn because they have a mythological belief which is probably not a myth, that there’s going to be some sort of activation of a planet into a star and this was directly laid out for the public to see at the end of Arthur C Clarke book and movie 2010.

NASA keeps trying to blow up these planets and igniting these planets to create some sort of awe-inspiring event for the public which they feel would help usher in their new world order by giving people something to focus on and drawing all the attention away from themselves. They are always looking for a big distraction so they can do something as big as 911 get everybody talking.

The more we learn about the planet Saturn the stranger it becomes. The spacecraft Cassini has fallen into the atmosphere of Saturn. With Cassini gone we’ll have no more visual access to the planet outside of our telescopes. What if the planet is something different than what we’re told? Is Saturn somehow controlling us in a very bad way? (It was. That’s over now-Lisa)You can change reality physically, actually holographically, that people are decoding. If you’ve got a headset on in a video game and someone puts another disc in then you’re all of a sudden decoding other information. When one looks to mythology and history it is soon discovered that many cultures and societies are somehow linked to Saturn. Why would so many varied human populations and groups have the most universal connection with Saturn?”

End of interview

Stay tuned…

Here is a very cool video from 2018 on Saturn losing it’s rings.

https://www.businessinsider.com.au/saturn-losing-rings-faster-than-thought-nasa-2018-12

Humans Resist Getting Organized But Feel So Much Better After They Do. It’s like Working Out.


Today is Red 6 Rhythmic Moon. Can you organize your feelings instead of acting on them?

What most people do is eat or drink alcohol more when they don’t want to deal with organizing their feelings. My “go to” lately are frozen yogurt bars. In the past it was bingey potato chips. Humans are addicted to feelings so avoid them. I believe Huey Lewis sang about being “addicted to love” but he meant the sexy, lusty, emotional kind, not the real kind.

The Moon has entered Sagittarius which the Virgo Sun forms a square to this afternoon during Blue 6 Storm. This could create some tension unless you know how to ignore pettiness and gossip.

Big minds discuss ideas, mediocre minds discuss events and small minds talk about people.

Eleanor Roosevelt

That sizes up our media in a nutshell. I guess that’s why I’m annoying. All I want to talk about is ideas and it stresses people out. My big idea with this blog is there is far more to our DNA and who we are in time and in our families than anyone realizes. I’m scoping out facts and research and then adding my intuition to the mix. One would think that would be valuable to a whole lot of people but most of them are busy reacting to what everyone else does or worse, following what everyone else does.

The Theme is Red 6 Moon, Analog is White 6 Dog, Guide Power is itself, Antipode is Blue 6 Storm and Hidden Wisdom is Yellow 6 Human so Mercury, Pluto opposing and Earth are strong players astrologically from the UNIVERSAL perspective, not the astrological perspective.Red Moon and White Dog are mediated by Mercury so the good part is a Mercury-Uranus trine opens us to creative ideas. The 5GForce is Blue 8 Monkey or galactic creativity, playfulness and illusion. It actually comes up as the Gateway in two days. The galactic tone is all about integrity and doing what you say you’re going to do. That creates harmony and a good example for others.

There is definitely a creative restlessness in the astrology and in The larger Matrix. Channeled well, these aspects encourage us to improve but otherwise might lead to over-indulgence, lack of moderation, or exaggeration. We need to be in touch with our feelings so we can moderate our expectations of ourselves and others.

Methionine is the start codon for the mRNA sequence and tryptophan sometimes functions as a stop codon so this could be a defining day or a type of test to see if we’re taking control of our vibe. Look at the similarity between White Dog and Yellow Human. Yellow Human just has the extra COOH molecule.

The tryptophan molecule with the presence of the hexagon and the pentagon is indicative of the influence of Jupiter and Saturn in holding our DNA together in the past. Now that that’s over I wonder if it will be replaced with something else or rehabilitated?

Saturday; Blue 9 Solar Storm


We know all about solar storms these days. There have been very, very strong ones from our Sun that have been affecting everything and everybody on earth in the last few months or so. Nothing on the sun is normal anymore and Earth is intimately tied to it since the Earth was born out of the Sun. Think of the Sun as our father and the Dark of space within which ALL resides as our mother. They are local universe parents.

In addition, The Schumann resonance has been off the charts. The Schumann resonances (SR) are a set of spectrum peaks in the extremely low frequency (ELF) portion of the Earth’s electromagnetic field spectrum. Schumann resonances are global electromagnetic resonances, generated and excited by lightning discharges in the cavity formed by the Earth’s surface and the ionosphere. They are known to affect the human body.

The cause of all of this is it’s time for earth to evolve forward, to take an evolutionary jump and activate our light body at a steady pace and join the universal stream. This is nothing new. Earth, viruses, bacteria, all plant life and rocks, animals, you name it have been evolving for GOOD PURPOSE now for billions of years. Humans are supposed to be part of the natural order and accept it. It’s not acceptable for Earth and humans to become artificial intelligence which has wreaked havoc in other parts of our universe. It’s not going to happen here. It’s only when our eyes and hearts close that we want to control others and have everything for themselves or have it our way. That’s done too.

The 5GForce is Red 5 Dragon of Radiant Blood Mother and Birth. It’s heavy energy that is bringing the power of feminine back to earth.

Today is Blue 9 Storm, Analog is Yellow 9 Sun, Guide Power is Blue 9 Eagle, Antipode is Red 9 Moon, and Hidden Wisdom is White 5 Wind

The body uses tryptophan to help make niacin, melatonin, and serotonin. Serotonin is thought to produce healthy sleep and a stable mood. In order for tryptophan in the diet to be changed into niacin, the body needs to have enough iron.

Searching for A Universal New Year: The relevance of August 13th. By Rohaan Solare (my friend)


Presently there is no universal basis for what qualifies the start of a new year. Every culture has its own set of parameters for determining it. The Chinese celebrate theirs in either late January or early February according their lunar calendar. The ancient Egyptians linked the appearance of the star Sirius and the annual flooding of the Nile river to signal the start of their new year. (Lions Gate 8/8/20) The many cultures of India celebrate the new year on various dates during the month of April. Europe’s Nordic cultures keyed it to the Winter solstice. The Celtic, Samhain, now vulgarized as Halloween, is celebrated by present day neo pagans, Wiccans and Druids as the start of their new year.

The Maori of New Zealand looked for the appearance of the Pleiades in May to signal the start of the new year. The Hawaiians also pegged their new year to the appearance of the Pleiades, but their new year fell in October.

The Aztec-Mexicans celebrated the new year in early March several days before the spring equinox. Even the Maya celebrate 2 different new years dates. One equates to February 22 and some celebrate July 26th. (Dreamspell Version)

And then there is Gregorian January 1st to mark the start of the new year for Westerners. January 1st was arrived at as the start of the new year in order to honor Julius Ceasar’s exploit as the founder of the “rational calendar”.

Contrast that line of reasoning with the fact that the new year of non-western cultures is related to some seasonal and/or astronomical aspect. The foregoing is why I refer to the Gregorian calendar as an urban calendar, for it reflects the whims of the city lords more than anything else.

The most common denominator for the start of the new year in most other calendar systems is the start of the growing season or end of the harvest season. In some cases, either of the solstices or equinoxes are recognized as the start of the year. The start of the new year for cultures other than the Euro-western is related to the agricultural, seasonal, and astronomical particulars of each region.

A Bi-Universal New Year?: Solsticial New Year

Many pre-Christian cultures of Europe’s northern hemispheric latitudes recognized the winter solstice as the start of the new year as the Sun symbolically dies and is reborn on that day.

The start of the new year cycle can be viewed as universal for those in northern hemisphere when reckoned from the winter solstice, and as defined by the life cycle changes that accompanies the attendant atmospheric conditions (rain, dryness, snow, etc) as the sun ascends and descends. The same would apply to those of the southern hemisphere, except that their new year would start with what we in the north refer to as the summer or June solstice. I prefer to designate the solstices according to the month they take place within rather than say summer or winter, because the seasons are reversed depending on which hemisphere you happen to live in.

The process of cooling and warming is minimized in most parts of the tropical regions. The most defining aspect of seasonal variation in the tropics is dry and rainy seasons. Nonetheless it is the Sun’s to and fro movement, and its attendant affect on atmospheric conditions that drives precipitation patterns. Therefore we can associate the start of the new year with the solstice that marks the start of a rising Sun for each hemisphere, since it is the rising solstice Sun that initiates the life cycle for each hemisphere.

The solstices do indeed provide us with fixed starting points for each hemisphere’s respective new year as it relates to the life cycle, but might there be a truly universal new year that applies to the entire planet as a whole regardless of local particulars?

The Arguellen Universal Calendar Proposal

Jose Arguelles proposed the universal adoption of what he calls the 13 Moon Calendar. Thirteen “moons”, or months of 28 days, plus one day would give a clean, orderly and easy to use civil calendar. (13×28 = 364 +1 = 365) I won’t go into all the reasons on why a uniform calendar is far better than the Gregorian hodge-podge we have now. But if you think about it some of the reasons should become clear. He was not the first to propose a new and improved universal calendar.

His calendar proposal is based on the Mayan Tun Uc calendar which also measures 13 months of 28 days plus one day. Arguelles anchored the start of his 13 Moon calendar to July 26th. But why July 26th? What is so special about that date? The followingquote from his website gives us his rationale. 

“For many ancient peoples, including the Dogon and Egyptians of Africa and the Maya of Central America, the great star Sirius, the brightest star in the sky, was the galactic marker. The heliacal rising of Sirius – July 26 – commenced the Egyptian year”. ~ Jose Arguelles

The problem with his rational is that its mostly inaccurate. Sirius did loom large in Dogon and Egyptian cosmology, but I have yet to come across any information indicating that it had any sort of calendrical function among the Maya.

Additionally, the Dogon did not use the star Sirius as a calendrical marker. And the start of the Egyptian new year is July 19th not the 26th and the helical rise of Sirius is also around the same time–July 19-20.

Lastly, we did not understand the concept of a galaxy until the 1920’s when we discovered, thanks to telescopes, that we inhabit one of billions of galaxies. The Arguellen account does not give us any reason whatsoever to say that July 26th is the start of some universally valid new year, even though he insists it is.

There are two testable and key parts to his universal year cycle proposal. One is that it starts on July 26th and the other is that each of its 13 months are characterized by a set of qualities in the same way that each day of the Tzolkin’s 13 day tone cycle has it particular qualities.

In other words the 13 day tone cycle is a fractal of the 13 month year cycle, as proposed by Arguelles. The first month of the 13 month year cycle carries the same qualities as the first tone of the 13 day tone cycle and so on. But this article will focus solely on the question of universal new year and its probable start date, if one exists.

So what else can be said about July 26th?

The 365 day civil calendar of ancient Mesoamerica was known as the Haab among the Maya and as the Xiuhpohualli among the Aztecs. The ancient Mesoamericans did not anchor their civil calendar to any part of the year in the way the Gregorian calendar does by adding a leap day every 4 years. This means that the start of Mesoamerica’s civil calendar year drifted by one day every 4 years.

At the time of the Spanish invasion, the first day of Mayan Haab calendar, “0 Pop”, coincided with July 26th, and hence forth the Mayan Haab was fixed to July 26th for unclear reasons. Spanish imposition is most likely the reason for the Haab’s fixation to July 26th.

July 26th is also significant for one other reason, for it is the day that the Sun is at the zenith over two of Mesoamerica’s most important pyramid sites. Teotihuacan marked the solar zenith passage date for the Toltecs and Edzna marked the July 26th solar zenith passage for the Yucatec Maya.

But there is still nothing universal about a Spanish imposition, nor are solar zenith passage dates, for they will vary according to latitude within the tropics of Cancer and Capricorn.[fig. 1]

Finding the Center of Space and Time

The Tropic of Cancer is Arguelles N. Polar Zone in assessing the DNA in synchronicity with the earth, and The Tropic of Capricorn is the S. Polar Zone for the same reason. In between them is the Zone of Transformation. This is the alignment in EVERY CELL OF DNA ON THE PLANET and accounts for the double helix and radial polarity. -My comments, Lisa K. Townsend

August 13th is most famous for being the alternative start date for the beginning of the Maya Long Count Cycle. There is a 2 day discrepancy between when the Long Count may have actually started. The account with the most backing says its August 11th, 3114 BCE, and that date gives us the end date of December 21st, 2012. August 13th gives us the end date of December 23rd.

The Zapotec-Shearer-Arguellen Tzolkin may be able to shed some light on that subject, but that investigation will be for another time. And after this analysis I am inclined to think that August 13th may carry more weight than August 11th. The other principle reason that August 13th is well known among Maya scholars is due to the unique timing phenomena that occurs on August 13th, at the latitude of 14.8 north. I will have to forego the extremely fascinating history behind the discovery of August 13th at the latitude of 14.8 N for this article, but I will relate what is most salient to my purpose here.

The latitude of 14.8 north has the distinction of being the place where the sun’s two zenith passage dates combine to equate interval periods of 260 days and 105 days (105 + 260 = 365). Two hundred and sixty days is the number of days in the Tzolkin cycle calendar, or the most revered body of knowledge in all of ancient Mesoamerica.

Zenith passage dates can only occur between the tropics of Cancer and Capricorn.[fig.1] As the Earth tilts on its axis, we see the Sun rise and fall in the sky over the course of the year. The tropics, or the lines of latitude just mentioned, mark the Sun’s northernmost and southernmost points of inclination and declination. The tropic of Cancer is located 23.5 degrees north of the equator, and it marks the day the Sun is directly overhead on the June solstice. The tropic of Capricorn is located 23.5 degrees south of the equator, and it marks the day the Sun is directly overhead on the December solstice.

It has been suggested by many scholars that the 260 day Tzolkin and the 365 day civil calendar were developed at the ancient ceremonial site of Izapa. Izapa is one of two major ancient Mesoamerican ceremonial centers that are located at the latitude of 14.8. The other site is Copan which is found on the border between Honduras and Guatemala. [fig.2] Izapa is located near the Mexican-Guatemalan border.

John Major Jenkins and a few others believe that the Long Count Cycle was calibrated at Izapa, and they are probably right about that, but from my vantage point I believe that neither the Tzolkin cycle nor the 365 day calendar were discovered or formulated there.

I won’t get into my version now, but I will say that I believe that the Ancient Mesoamericans (AMA) sought out the place where the two primary measures of time, the Tzolkin and solar cycles met in perfect harmony.

Such a place would be nothing less than the place where the “Heart of Earth” meets the “Heart of Heaven” within their worldview. The Heart of Earth being the 365 pulses (beats) that we experience as a day-night cycle, and the Heart of Heaven being the 260 pulses of the Tzolkin cycle. In other words, the Tzolkin was regarded as the primary or cosmic timing standard. The implication is that the solar cycle is a local timing standard, particular only to our unique place in time and space, but nonetheless supremely relevant to why our solar system harbors life.

Orienteering 101

In order to show what is meant by the foregoing, let’s begin with the Sun at the December solstice. On the Sun’s northward journey it crosses the zenith over Izapa on April 30th.

The Sun continues climbing until it stops its northward journey on the June solstice, or the day the sun is directly over the tropic of Cancer, and once again begins its southward journey toward the winter solstice. On its southward journey it will again be directly over Izapa on August 13th for its second zenith passage.

Please note that our warming season from winter to summer solstice corresponds to when the earth’s northern hemisphere is tilted toward the sun and the opposite is true in the winter time.

April 30th to August 12th equals 105 days and from August 13th to April 29th there are 260 days. (260+105=365) The two solar zenith passages are separated by 105 days in the former interval, and by 260 days in the latter.

The interval from August 13th to April 29th places the December solstice smack dab in the middle at 130 days or one half of a Tzolkin Cycle.

Furthermore, there are 52 days from the summer solstice to August 12th, and we well know that the number 52 was highly revered by the AMA for its meaning within their understanding of time.

August 13th would be the equivalent of our January 1st and August 12 would be the same as December 31st.

But why August instead of April?

August 13th came to be known among the AMA as “the day the world was born” and “as the place where time began“. But why did they pick the August zenith passage date over the April zenith passage to anchor the “day the world was born”, and mark the start of the new year and the Long Count cycle?

The one thing that comes to mind is that they recognized the December solstice as the start of the solstice to solstice year cycle, and so that would make the August zenith passage the second or completing zenith passage date, hence completing the centering aspect of the Sun’s passage and the next passage date is a full 260 days away with the winter solstice perfectly balanced between the 2 zenith passage dates.

We must remember that one of the AMA’s most important cosmological quests was worldcentering, therefore they would value counting the year cycle from center point to center point, rather than from extreme point (summer solstice) to extreme point (winter solstice) so to speak. Following this line of reasoning, I looked to the night sky to see if it could shed some light on this subject.

I set my astronomy software to 3114 BCE to see if the night or day sky at the zenith time over Izapa might reveal something telling about why else the August 13th zenith date might have been favored over April 30th. I discovered that the Milky Way straddles the north-south meridian at midnight in such a way as to form a perfect cross just 20 degrees from the zenith. The four quarters of the world are made manifest by such an event, and the observer is at the very center of it all. On April 30, the Milky Way is not perpendicular to the zenith meridian until the dawn.

The actuality of the evening’s most revered object, the Milky Way, forming a cross with the north-south meridian at the zenith and at midnight, on the same day that the day-time’s most revered object, the Sun, is at the zenith only reinforces the idea of August 13th as the center of space and time in the most literal of terms.

There is one other consideration, and that is the agricultural season. The first corn crop is sown to coincide with the start of the rainy season around the end of April-start of May – the time of the first zenith passage. The first harvest happens right around the middle of August or near the second zenith passage. We know that harvest time is often a factor for pin pointing a year cycle start date among other cultures, but this aspect, unlike the first two, is not a universal condition, and we are looking for universal parameters.

August 13th: Ancient Mesoamerica’s Universal New Year

It seems that August 13th was regarded as the start of a universal new year among all major pyramid building cultures of Mesoamerica. It has been found that at least one major aspect of almost every major ceremonial center has an axis or focal point of some sort aligned with the sunset of August 13th. In other words it was widely acknowledged that Izapa was situated at the “Heart of Earth” and that the work done at Izapa was supremely important to the foundation of Mesoamerican cosmology.

In acknowledgement of Izapa and August 13t, other ceremonial centers oriented at least one major structure toward the sunset of August 13th. In other words Izapa represented nothing less than the place where the tangible fulcrum of earthly time, and the intangible fulcrum of cosmic time met in perfect harmony.

Three hundred and sixty-five days is the measure of earthly time and 260 days is the measure of cosmic time. Heart of Earth and Heart of Sky are two very important metaphors in Mesoamerican cosmology, for they too, like so many other cultures, recognized that everything emerges from some infinitesimal center place.

The perceptible Heart of Sky is the zenith, and also from Izapa they discovered the intangible, but supreme center of our local universe, or the heart of our Galaxy.

So it was that they developed the Long Count to calibrate when Father Sun would be reborn from the Cosmic Mother. (Jenkins Maya Cosmogenesis). By doing so they achieved the holy grail of Mesoamerica’s other great quest known as Worldrenewing.

For more on the concepts of Heart of Earth-Heart of Heaven and Cosmic and Earthly time, please see Cosmic Time Meets Earth Time: The Numbers of Supreme Wholeness & Reconciliation Revealed

Before concluding I want to go back to July 26th. As mentioned earlier the zenith of July 26th was marked by the ceremonial centers of Edzna in the Yucatec Maya lands, and at Teotihhuacan – land of the multi-culturally composed Toltecs.

Edzna was the first major ceremonial center of the Yucatec Maya and Teotihuacan was the major ceremonial center for the highland Toltecs. The pre-imminent Maya scholar Vincent Malmstrom thinks that the northern periphery of grand Mesoamerican culture, as marked by Edzna and Teotihuacan, switched the official start of the new year from August 13th to July 26th.

According to Malmstrom, a calendar reform of sorts took place in the year 48 CE, in which July 26th became the new “new year” start date for the Yucatec region and Teotihuacan, since both centers were built where the sun is at the zenith on July 26th.

We don’t know exactly what prompted this change, but Malmstrom thinks it had to do with having a “locally relevant new year”. It may have been a political tactic to establish Edzna as the new power center of an emerging civilization.

Even so they continued to acknowledge the universality of August 13th as they made sure that one axis of a major pyramid was oriented toward the setting sun of August 13th. August 13th became a foundational orientation to many if not all major ceremonial centers.

Earlier I mentioned that the Maya civil calendar, the Haab had been fixed to start on July 26th at the time of the Spanish invasion. Thus the prominence of July 26th in the historical record was doubly reinforced, since the roving start date of the civil calendar, and the July 26th solar-zenithal passage new year are two distinct ways of measuring the year cycle.

Recently I met a Maya man from Guatemala, and he did confirm that July 26th is still recognized as the first day of the new year, and this had nothing to do with the Arguellen proposition to create a new universal calendar with July 26th as its start date. Arguelles it seems borrowed the start date for his universal calendar proposal without giving full disclosure as to why he had chosen that date.

Conclusion

August 13th has a couple of strong reasons as to why it’s a prime candidate for a universally valid start of the year. July 26th is another serious choice because of its strong presence in the historical record. However, there are problems with the July 26th date because we have yet to discover any universally valid properties to that day.

Whatever the case, the month of August looms large in the historical record as it relates to the story of 2012 and Mesoamerican history. The following list of events only seems to affirm the significance of the time period called August:

  • Either August 11th or 13th is the start date of the Long Count Cycle.
  • Hernán Cortés began his march on the Aztec capital on August 16th, 1519.
  • The Aztec Empire fell on August 13th, 1921.
  • The atomic bombings of Hiroshima and Nagasaki happened on August 6th and 9th respectively.
  • Tony Shearer fulfilled the prophecy of the 13 Heavens and 9 Hells prophecy cycle by calculating its end date on August 16th-17th, 1987. The fact that Arguelles was able to successfully convoke a global gathering on those two dates (Harmonic Convergence) lends even more weight to mid-August as some sort of peak moment in the solar cycle.   Harmonic Convergence was a major event in the history of humankind, for it was the world’s first global ritual event and it took place before the internet was publicly available.

Those of you familiar with my article on Anticipating Personal and Collective Shifts in relation to MAC Time Science, should consider mid-August 13 as a cycle juncture window. A cycle juncture window is a period of time before and after a cycle ending zero date or August 12th in this case. Shift-type events are most likely to happen during a cycle juncture window; review the article in question for more details.

May you all have a joyful August 13th!

Continue reading “Searching for A Universal New Year: The relevance of August 13th. By Rohaan Solare (my friend)”

Recently Retired USAF General Makes Eyebrow Raising Claims of Advanced Space Technology


The U.S. currently possesses revolutionary technologies that could render current aerospace capabilities obsolete: “[M]ost Americans and most members of Congress have not had time to really look deeply at what is going on here. … [T]echnology can be built today (that can)… deliver any human being from any place on planet Earth to any other place in less than an hour.”

Article by Brett Tingely                         December 11, 2019                         (thedrive.com)

• US Air Force Lieutenant General Steven L. Kwast (pictured above) served as Commander of the 47th Operations Group at Laughlin Air Force Base and the 4th Fighter Wing at Seymour Johnson Air Force Base, and had support within the Armed Forces to be appointed as the Commander of the Pentagon’s Space Force. Instead, Kwast retired this past September. On November 20, 2019, Kwast gave a lecture titled “The Urgent Need for a U.S. Space Force” at Hillsdale College in Washington, D.C.

• In his talk, Kwast claimed that China is already building a “Navy in space” complete with the space-based equivalents of “battleships and destroyers”, and that the US is not keeping up. We know that China has been rapidly expanding its presence in space in recent years, placing a lander on the Moon last year as a possible first step toward a permanent Moon base. China has also been developing “mothership” aircraft from which to launch ‘space planes’ and other payloads into space. China has been investing heavily in manned and unmanned space technologies that rivals, and in some ways, exceeds our own. Kwast believes we need a Space Force in order to counter Chinese advances and win the competition over the economy of the future and, as an extension, the political values for the future.

• Kwast says the “the power of space will change world power forever” and that it’s up to the United States military to leverage that power. The nature of the power of a competitive advantage is “you either have it and your values rule or you do not have it and you must submit. We see that play out again and again in history and it’s playing out now,” Kwast argues. “[China] will pass us in the next few years if we do not do something. They will win this race and then they will put roadblocks up to space.”

• Around the 12:00 mark in the speech (see video below), Kwast makes the somewhat bizarre claim that

The U.S. currently possesses revolutionary technologies that could render current aerospace capabilities obsolete: “[M]ost Americans and most members of Congress have not had time to really look deeply at what is going on here. … [T]echnology can be built today (that can)… deliver any human being from any place on planet Earth to any other place in less than an hour.”

• Other military leaders have made curious comments lately alluding that we could be on the precipice of a great leap in transportation technology. There are many within the U.S. military and analyst community who feel a great need to boost investment in American space technologies and the U.S. military’s presence in space. That vision is taking root across the Defense Department.

• Kwast has published several op-eds in recent years pushing for the U.S. military to take on a greater role in space in order to ensure American economic dominance and what he sees as the continued proliferation of American values. Some have said that Kwast was blacklisted and prematurely relieved of his duties after speaking out on space-related issues in violation of a service-wide gag order. Kwast declined to comment.

• Is all this setting the stage for a new space race that will benefit mankind by furthering scientific and technological development, or is it ushering in the conditions for the first great space war?

Recently retired U.S. Air Force Lieutenant General Steven L. Kwast gave a lecture last month that seems to further signal that the next major battlefield will be outer space. While military leadership rattling the space sabers is nothing new, Kwast’s lecture included comments that heavily hint at the possibility that the United States military and its industry partners may have already developed next-generation technologies that have the potential to drastically change the aerospace field, and human civilization, forever. Is this mere posturing or could we actually be on the verge of making science fiction a reality?

Who Is Steven Kwast?

According to his official USAF biography, Lt. Gen. Kwast graduated from the United States Air Force Academy with a degree in astronautical engineering, and also holds a master’s degree in public policy from Harvard’s Kennedy School of Government. Kwast previously served as Commander of the 47th Operations Group at Laughlin Air Force Base and the 4th Fighter Wing at Seymour Johnson AFB. Kwast boasts more than 3,300 flight hours in the F-15E, T-6, T-37, and T-38 and over 650 combat hours.

Lt. Gen. Kwast most recently served as Commander of the Air Education and Training Command (AETC) at Joint Base San Antonio (JBSA), but retired in August. According to some reports, Kwast was prematurely relieved of his duties at JBSA and blacklisted for promotion after speaking out on space-related issues despite a service-wide gag order. Kwast declined to comment on the reports and retired on September 1, 2019.

Despite the controversy surrounding his removal from his post at AETC, some defense analysts and Lt. Gen. Kwast’s own supporters within the Armed Forces were suggesting prior to his retirement that he should be appointed as Commander of the Pentagon’s budding Space Force. Kwast has published several op-eds in recent years pushing for the U.S. military to take on a greater role in space in order to ensure American economic dominance and what he sees as the continued proliferation of American values.

Gaining The High Ground In Space

Kwast delivered a lecture at Hillsdale College in Washington, D.C. on November 20, 2019, titled “The Urgent Need for a U.S. Space Force.” Kwast’s wide-ranging speech described the power of new technologies to revolutionize humankind, referencing the competitive advantage the discovery of fire offered to early humans and the strategic value that nuclear weapons offered 20th-century superpowers. When it comes to current revolutionary technologies, Kwast says the “the power of space will change world power forever” and that it’s up to the United States military to leverage that power: “As a historian, reflecting on the fact that throughout the history of mankind… technology has always changed world power. But the story of rejecting the new and holding and clinging to the paradigms of the past is why no civilization has ever lasted forever, and values are trumped by other values when another civilization figures out a way of finding a competitive advantage. The nature of power, you either have it and your values rule or you do not have it and you must submit. We see that play out again and again in history and it’s playing out now.”

As has been common as of late, Lt. Gen Kwast cites rapidly growing Chinese military and technological advances as the reason why the United States must invest heavily in new space-based technologies. “We can say today we are dominant in space but the trend lines are what you have to look at and they will pass us in the next few years if we do not do something. They will win this race and then they will put roadblocks up to space,” Kwast argues, “because once you get the high ground, that strategic high ground, it’s curtains for anybody trying to get to that high ground behind them.”

1:06:24 video of Steven Kwast on the Need for Space Force (‘Hillsdale College’ YouTube)

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that. I agree with social distancing but not the masks. Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

We Meditate in Order to Focus. Our Thoughts are Seeds.


The planet on the right is Jupiter. Meditation is channeling and focus is targeting. Those are Yellow 7 Seed Attributes. We meditate within our bodies and then our body/mind interacts with MIND all around us. We can choose what we let in and what we don’t. Activating the power of our minds is frankly the only way we’re going to get out of this mess of others controlling the human race. We’ve let this happen by default.

Yellow 7 Seed resonates AWARENESS of the context within which we live and have our BEing. A physical seed is a DNA seed packet that drops to the earth and sprouts. A woman’s egg is a DNA packet that drops in the uterus, is fertilized and creates a human. That is an exact analogy to our MIND seed packets that we drop in the ether and they literally sprout. I’m asking you to meditate on the LITERAL nature of THE MIND and TIME as DNA and the power of Life Force that it has.

Look at the phenomenal plant life on earth that came from a tiny physical seed! Now imagine that 100 times or more with the power of human intention backed up by the timeless universe with regard to our thoughts and feelings. You may assert your positive gratitude and happiness path a bit harder instead of indulging in anger and pettiness on social media next time. The whole planet needs to PIVOT on that. I deactivated my Twitter account. That thing is TOTALLY negative. So is T.V. Negative mindset is the most destructive thing on the planet and we should not be part of it. In essence, we’re destroying ourselves if we do but maybe that’s what some people want because they literally don’t believe that Love and Goodness exist in the Universe. They don’t believe there is a God. Ok, then!

This process is called ATTUNEMENT and is also an attribute of RESONANT TONE 7. I am a Reiki Master and teach Reiki classes and do attunements for my students. Their mind and body has become aware of their Qi or Ki and now they have learned how to FOCUS their QI to heal themselves and others. It’s not much different than tuning up a musical instrument or the singing voice. I am also a degreed musician. The musician and actually all artists are athletes in that our creative expression comes through our body. You have to be in shape and in tune with your biorhythm to do well in your craft. That’s also the case with bodyworkers.

Being a Reiki Practitioner is like being a gardener organizing and tending to their garden. Each client is a Seed that wants to get comfy in the soil of their body and SPROUT! ReiKI is like the SUN.

The 5GForce today is Yellow 7 Warrior, the GUIDE POWER. That’s odd. The Moon was in Sag and is now in Capricorn so there is some affinity today between Jupiter and Saturn on every level.

  • The Theme in the middle is Yellow 7 Seed, Valine
  • Analog is Blue 7 Eagle, Arginine
  • Guide Power is Yellow 7 Warrior, Histidine
  • Antipode of White 7 Wizard, Lysine
  • Hidden Wisdom is Red 7 Earth, Phenylalanine.

The pentagon in histidine is tetrahedral which is the Hydrogen molecule. It appears to me that Jupiter has had a major role in making sure hydrogen is distributed to planets that are going to evolve life. Saturn has the hexagon which is in Phenylalanine. JUPITER is the mediating planet today.

Organizing Your Mind; How?


I and millions of people meditate daily. I’m addicted to it. I’d put it right up there with great coffee or sex. It’s a tonic for the mind. Humans are different in the animal kingdom in that we have the ability to be self-reflective. I’m trusting my readers are able to ponder their feelings, actions, motives, and past experiences so they can learn who they really are. If you do start to ponder it’s easy for your mind to start to spin with ideas, memories, thoughts, feelings and intuitions.

In order to make some real progress with mental focus, it’s helpful to decide what you’re going to focus on mentally and put the others in a folder in the back of your mind. In order to do that, you must be clear on what you want to accomplish that day and what your time looks like. Make this decision before you meditate. That way, your spirit guides know what you need help with. You decide, they don’t! On other days, I’ll observe some odd inclination I’m having and figure out what I’m feeling to understand why I’m doing it.

The truth is, my life is extremely abundant and I’m grateful daily. I mostly did it myself but definitely had help. We all have help reaching our abundance goals whether they be psychological, money, or spiritual. You have to start by asking for help though which means getting past your ego.

Today is Blue 6 Night which hands us the energy to pulse musically with what makes us feel good, focused and abundant. Let’s keep the definition of abundant open to more than money. Enough money is definitely an important tool but it doesn’t bring health, mental stability or clarity about feelings. I think money is only 15% of abundance. Loving yourself and knowing how you feel is 75% of abundance. Liking your body set up is the other 10%. I guess I’m speaking for myself.

The analog and guide power are Yellow 6 Warrior and Blue 6 Night again. Saturn is the mediating planet. Therefore our minds are disciplined with help from Saturn to decide what we’re going to think about and not think about. There is no compulsion here. Just make a simple decision and do it. Sometimes it’s that easy.

The antipode is Red 6 Skywalker which compels us to movement and exploration in order to distract ourselves from getting our thoughts in order. I am Skywalker and I get bored so easily having to focus on one thing. It’s truly maddening to have to apply my antipode, this Blue Night theme to my mind. I compromise through my writing. Writing allows me to continue o explore the ether creatively while sitting still. I do manage to get things done but they’re not usually as perfect as I’d like them to be.

The Hidden Wisdom is White 8 Mirror, galactic reflection! That’s a good reason to sit still. The galaxy is unlimited and there is so much hidden from us by State and Church. They keep all the info. left on this planet for themselves. Order is one of the attributes of White Mirror though so we have double, maybe triple help getting something fruitful done. Have a great Thursday.

MOLECULAR LINE-UP

We see the Jupiter pentagon on the histidine molecule while the Moon is in Sagittarius. Jupiter rules Sag . And we see the Saturnian hexagon on the tyrosine molecule with the Saturn attributes or order, discrimination, ritualistic, discipliner, well coordinated and practical.