Tweet from Edward Snowden (@Snowden)

Edward Snowden (@Snowden) Tweeted: Amazon announces Spyware-as-a-Service:

Siege on the White House and A Massive Solar Flare? A Disclosure Timeline…possibly.

Blue 7 Resonant Night, Analog is Yellow 7 Warrior, Guide Power is Blue 7 Eagle, Antipode is Red 7 Skywalker and Hidden Wisdom is White 7 Mirror.

I’m going to lay out an important predictive timeline that impacts everyone according to the flow of multidimensional True Time in the Tzolkin Harmonic Code for the rest of the month.

In addition Mars goes retrograde in Aries tomorrow and is the mediating planet for Red Skywalker and White Worldbridger. It’s amino acids are Q and T! Any aggression or just wars initiated from the left or right for the next few months will backfire.

The Tone of Creation for today is RESONANT which means those of us who are mediums of Spirit and Channel will be humming. The energy is like a boomerang in a cave and we can read it. We don’t absorb it, we read it for the benefit of regular people and other lightworkers.

Today is all about intuition, vision but with intelligence and analysis applied. Intuition takes more than channeling. It’s important to understand the natural forces that are at work in an orderly manner. I’m not indulging in emotion that fogs my rational mind, reacting or absorbing other people’s energy. I just read it like a book. The rational mind and the intuition work hand in hand. From my end, it’s just the Tzolkin Harmonic. There are others.

This predictive Timeline has to do with the upcoming advertised “Siege on the White House” by alleged anarchists, for what it’s worth. Chaos mongering is what it’s worth and making the administration look better when they quell it quickly. They say they’re going to do it on September 17, 2020. Feel free to Google it and see for yourself. The synchronicity is that Trump’s Birth Gateway is the analog support; Blue 3 Hand for that day. That is a major synchronicity which means Trump either supports the Siege and has a hand in it or he is going to benefit from it. Who knows what these politicians motives are except to win elections. I am apolitical. The day lands on Yellow 3 Electric Human. I’m sure they will be an electrified group of humans with some violent opinions and the U.S. military will have to respond.

The purpose of this blog is that we are due for a massive Solar Flare from our sun that will possibly wreak some dissolving havoc our our planet, our minds, and our satellites. This may be what brings the internet down for three days and according to the Tzolkin, I predict it will occur on or about September 22-25, 2020, Red 8 Earth to Yellow 11 Spectral Sun, after the advertised “Siege”. Nancy Pelosi’s birth gateway is Red 8 Earth by the way. That book ends an 11 x 2 = 22 Solar date with a Tone 11 Yellow Sun Mayan date so it’s 11:11 ascension coordinate.

We are currently, today, in HF 41, 4D, Hx37; The Family, The Clan. In 3D that is focus on the subconscious mind programmed for us in utero by our mother’s. It’s past time to have moved beyond our past programming into the conscious adult mind of our own choosing.

There is one more day in this harmonic. On Thursday we enter HF42; 4D Red 9 Solar Serpent

The day after this Thursday is September 11, 2020, White 10 Planetary World Bridger which is also John F. Kennedy’s birth gateway! More synchronicity. Q contends that JFK Jr. is alive to avenge his father’s assassination by the Democratic Party, LBJ and the CIA leading the way in that scheme. His death in the plane crash was allegedly faked. It’s not as though no one has ever faked their death before. I don’t find it unbelievable. There is quite a bit of source material on this which I have not investigated because I can feel that it’s true. Again, feel free to Google it. Who is QAnon? JFK Jr. This one is double synchronicity. The 19th anniversary of 9/11/01 falls on White 11 WB and JFK’s (the President) Mayan Gateway.

The reason JFK was murdered was that he knew about the SSP, the Secret Space Program and the LOC, Lunar Occupation Command on our moon and was going to tell the American People. That was the whole point behind going to the Moon which NASA largely manipulated so on one would see what was actually going on up there. The Deep State, prime motive being profit and expansion of aerospace, tech, big oil and slavery for humans for profit were not going to have any of that. LBJ had connections to big oil and took care of it.

This Saturday, 9/12/20 is Blue 11 Hand. Then Sunday, Yellow 12 Star the Galactic Synchronization begins which no human can control. The Star tribe is mediated by Venus so it’s very possible the Anshar and the Mayans underground are monitoring or helping with the event on the surface to benefit humans. Both of those groups are Venusian, our allies, on our side and always have been.

This day and the next 3 after that are the 5GForce for the gateways for Harmonic Family 33, in the center of the Tzolkin which have no 3D IChing governance. They are kin 129, 130, 131, and 132. Starting THIS SUNDAY, Sept. 13, 2020 the galactic 5th dimension gears up to shift into Disclosure, alignment of the Truth and freedom for surface dwellers. So Sept. 13, 14, 15, and 16 is the 5th dimensional power up.

That takes us to September 17, 2020, Thursday, the planned Siege Day, Yellow 3 Human with Trump’s analog Blue 3 Hand. We’ve got a Grade B Movie of the week to watch from Sept. 17 through the 25th and at some point in there I predict the Solar Flare will start and there will be some kind of friendly E.T. invasion event, Disclosure event or both which will be broadcast on T.V.

  1. September 13, 14, 15, 16-5D GForce power up from HF33.
  2. September 17th, alleged advertised (geez) “Siege on the White House”
  3. That may go on for a week? September 17, 18, 19, 20, 21, 22 (gear up on the Sun for the massive Solar Flare), 23, 24 and…
  4. September 25 is Yellow 11 Sun. The end of the lies, the Deep State, the Human Trafficking, the control of the Media, the secrets kept from us.
  5. DISCLOSURE for the benefit of humanity will begin.


It’s time for a better life on the surface, free of human slavery, oil, gas, and coal energy and gender disparity.

The Artificial Covid19 Sequence Will Likely be Unsuitable For a Vaccine. By Dr. Fernando Castro Chavez.

Dr. Chavez is currently working with the 2008 Nobel Laureate Luc Montagnier, the founder of the HIV retrovirus, on fleshing out the true nature of the Covid19 signature and he’s my friend. In between his important work I’ll get his attention, which I already have somewhat since he is familiar with the Mayan system as well and we are on the same page as we talk. Much of his work has fueled my project and I’m very grateful. -Lisa T.

“To the current director of the NIH:

As a Postdoctoral student of Molecular Biology, my focus has been on analyzing the sequence of the current COVID-19. It is so alarming to find the artificiality within it, that I have written to NIH director Frances S. Collins, entitled “A Vital Letter On The Preservation Of Humanity As We Know It”:

Dr. Collins,

As I have had the blessed confidence to write to a brother in Christ since day one, I am sending you this important message. With my best regards,
Fernando Castro-Chavez, PhD.

I could not fit this vital link into the letter that independently exposes the hoax imposed on humanity 19 years ago. Let us do all we can to prevent this from happening again but on a wider scale.



Prompted by this article: Jun 25, 2020 – Health: The NIH claims joint ownership of Moderna’s coronavirus vaccine: (, I write to you, saying that we had a deep respect for you (my sister, my girl companion and my peers). The first letter I wrote to you was about Creation, in 2000, just having arrived from my country, written in bad English at least I was willing to live the American dream!!!

Then, we saw you in person and introduced ourselves. You went to the BMC to give a speech about The Human Genome Project, I remember that you said something like: “Mendel is also there, in this slide, right there at the corner…”; then I wrote about our dreams to pursue, not only this Postdoctoral couple of jobs in Medicine but also an MD Career. We two are starting again from scratch. Dreaming to be truthful and to really help humanity… However, now, I dedicate myself to you my current findings, humble, but nonetheless, they are still findings:

1) “COVID-19: AATGGTACTAAGAGG (NGTKR) = HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene (GU455503)”. Finding also done by:

2) Shi Zheng-Li, from the WIV at Wuhan and co-author of Ralph Baric. She distinctively calls it an “INSERTION” (she puts it as GTNGTKR, GGGACCAATGGTACTAAGAGG, adding other two more, but skipping the key one: The Furin Site!), whose putative function is immunosuppressant, as she says that those INSERTIONS have: “sialic-acid-binding activity”, at Zhou, P., plus 27 et al & Zheng-Li Shi.A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020:579:270-73, & 16pp:; a third group that found these unique INSERTS is that of:

3) Sørensen (identical to the previous one: GTNGTKR, but also studying, to leave no doubts, its functional span by performing 6 by 6 NT iterations containing our sequence of interest (and of many others), such as VSGTNG, SGTNGT, TNGTKR, NGTKRF, etc.), who says in an interview, as he found many more INSERTS (saved at “The INSERTED sequences have a functionality that we describe.

We explain why they are essential: …accumulated charge from inserts and salt bridges are in surface positions capable of binding with cell membrane components other than the ACE2 receptor.” This statement is very important and indicates that if we realize that this virus is NOT natural we could be and could have been better prepared since the start to fight against it in a more logical, rational, and prepared way, which did not happen. The artificiality of the virus also makes it unsuitable for vaccination, instead of the opposite, because that is the way the human tampering of nature works. The attempted purpose of its design is to do one thing, and it happens to result in just the opposite thing than what was wanted: “…the naked coronavirus spike protein as a concept for the basis of a vaccine, which we have rejected because of a high risk of contamination with human-like epitopes.

Analysis of the Spike protein of SARS-CoV-2 shows 78.4% similarity with human-like (HL) epitopes…” and “… A search so tailored to match against all human known proteins will give a 78.4% human similarity to the SARS-CoV-2 Spike protein, i.e. if all epitopes on the 1255 amino acid long SARS-CoV-2 Spike protein can be used by antibodies then there will be 983 antibody binding sites which also could bind to epitopes on human proteins…”The original article delving into all of those technicians is: Sørensen, B., Susrud, A. and Dalgleish, A.G. Biovacc-19: A Candidate Vaccine for Covid-19 (SARS-CoV-2) Developed from Analysis of its General Method of Action for Infectivity. QRB Discovery (by Cambridge University Press) 2020:17 pp [Accepted Manuscript]:

This important article clearly indicates that if we do NOT realize the real origin and the real nature of this virus, we will continue to be deceived as per its treatment and its strategies of attack, and will be responsible for having on purpose dimmed the light of its artificial origin. Especially when we all are aware that the authors of “The Proximal…”, Andersen et al. Nat. Med. 2020 article have been written by reefers that have ever been used for political purposes rather than scientific ones.

So, apart from as these three independent findings of that and many more related HIV sequences, we have another two sets of witnesses, totaling FIVE independent groups finding this: Mine, Zheng-Li’s, and Sørensen’s, but also:

4) Pradhan, from the Indian group that was forced to withdraw its article, who calls the contained sequence under consideration as the previous ones: “INSERT 1″: TNGTKR, elongating the set of meaningful nucleotides as TCTGGGACCAATGGTACTAAGAGG (SGTNGTKR): Pradhan, P. et al. Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag. Biorxiv 2020: 14 pp. (Withdrawn, 128 comments):, they start describing their findings as follows:”We found four new insertions in the protein of 2019-nCoV- “GTNGTKR” (IS1)…”, but this is not all, but also a fifth group, being this the one integrated by:5) Perez and Montagnier (2008 Nobel Prize in Medicine, precisely for his discovery of the HIV virus), and they describe our found sequence within, together with a couple of tens more: TCT GGG ACC AAT GGT ACT AAG AGG TTT GAT AAC CCT G (SGTNGTKRFDNP…, finding them in here, fragments of SIV joined to the HIV-1A that I found, and sown in point “1”), from these sequences found by them, they start and end their meaningful conclusions, coming from the wisest of men, as follows:1) 18 RNA fragments of homology equal or more than 80% with human or simian retroviruses have been found in the COVID_19 genome;

2) These fragments are 18 to 30 nucleotides long and therefore have the potential to modify the gene expression of Covid19. We have named them external Informative Elements or EIE;

3) These EIE are not dispersed randomly, but are concentrated in a small part of the COVID_19 genome… …everything converges towards possible laboratory manipulations which contributed to modifications of the genome of COVID_19, but also, very probably much older SARS, with perhaps this double objective of vaccine design and of “gain of function” in terms of penetration of this virus into the cell. This analysis, made in silico, is dedicated to the real authors of Coronavirus COVID_19. It belongs only to them to describe their own experiments and why it turned into a world disaster: 400 000 lives, more than those taken by the two atomic bombs of Hiroshima and Nagasaki.

We, the survivors, should take lessons from this serious alert for the future of humanity. We urge our colleagues’ scientists and medical doctors to respect ethical rules as expressed by Hippocrates oath: do no harm, never and never!”; an earlier manuscript of them can be found at Perez, J.-C., and Montagnier, L. COVID-19, SARS and Bats Coronaviruses Genomes Unexpected Exogenous RNA Sequences. ResearchGate & OSF 2020:43 pp. [Older Manuscript]:

I started my letter saying that I used to have respect for you. However, the standing taken as to ignore the real origins documented by these five research groups and by countless others, of the whole pre-planning of the current Pandemic by COVID-19, has made me change my current opinion about you.

6)Arumugham also discusses such “Artificial selection at work… via recombination with HIV-1 derived inserts and selecting the viruses for efficient human kidney cell infection”, and my comment is again that to notice this artificial origin of COVID-19 is very important to do the proper treatment to patients, and to prevent another thing like this from emerging out of a Gain of Function “research”: Arumugham, V. Root cause of COVID-19? Biotechnology’s dirty secret: Contamination.Bioinformatics evidence demonstrates that SARS-CoV-2 was created in a laboratory, unlikely to be a bioweapon but most likely a result of sloppy experiments. Zenodo 2020:9 pp. (Manuscript saved at:

My experience on finding human artifacts on genomes dates back to the EcoRI palindromic linker that is contaminating thousands of sequences in the Genbank: Castro-Chavez, F. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes. DNA Cell Biol. 2012, 31(2):151-63:

The freedoms of the whole humanity are at stake and the good God The Creator that you deeply respect, has put you in a key position as to be able to revert as soon as possible the current decline of the human values, and of the human nature in general, and this all because of a deliberate release of the current Sars-CoV-2. 9/11. It was the first False Flag Operation aimed at stealing as many freedoms as possible from the human race, and the Fake Anthrax Attack of 2001 had the same purpose, releasing a pre-planned and the very anti-patriotic document called the “Patriot” Act, which also included an immunity clause preventing the Pharmaceutical Industry of even more liabilities, but it was contested by the population, and it was removed. So, I wish to stop the GoF initiatives.

Here we are today, contesting the “official” narrative of the current Plandemic as we did in the past with the “official” narratives of 9/11 when we discovered nano-bombs and fake planes injected into the TV screens. I expect to publish this letter out in the open after you have read it. Only history will tell if TRUTH was able to win on this time over darkness, or if the criminals will get away once more… With my same thinking as at the beginning of the current letter (but praying that this could very soon change),

Fernando Castro-Chavez, PhD.

P. S.

My ongoing work can be found at the ResearchGate. While many pieces of it have been removed from Facebook and from the YouTube by some heartless and brainless censors appointed by the WHO and by their owner, Bill Gates, apparently the mastermind, chosen by the globalists to pull this event of an artificially manufactured viral harm for the whole of humanity, it is there. But as Mordechai told to Esther: “If you do nothing about it, God will raise somebody else to redeem us of this plague, because our clamors for freedom and for justice have already reached the Heavens”. Jesus said that it will not be so easy for the believers to overcome evil in the current times, but that it could be possible. As Christian believers, we believe that as long as we continue over the earth, the total fruition of the plans of darkness can NOT prosper, and you may be a key member of the Body of Christ in order to fulfill such restraining against the forces of evil of this world. Thus far, the next are some of the sequences that seem to be inserted (some of them seem to have been started to be tampered with since the RaTG13 “experiment” of Shi Zheng-Li, a genome she had since 2013 but that she did not publish until 2020 after the first Sars-CoV-2 had been published in China, a genome that of the RaTG13 (previously published in part twice with different names that included the number 4991.

That is dishonesty in science to change the names of the sequences, and that is what Shi just did!). It has been used, ironically, even with all its methodological anomalies, to precisely attempt to undermine the artificiality of the inserts. Even two sequences published earlier by the Chinese Military seem to have been already tampered with to make them more infectious. This is what happens when you only have the sequences provided by them with nobody else corroborating their authenticity), so, I may use the “probable” inserts clause, mostly from HIV-1, some few from HIV-2 and one from SIV (as explained by Perez & Montagnier, 2020).

So, the number of artificial sequences is growing as research progresses, that is why, when people try to discredit some of these from being artificially made, the burden is over them to explain how all of them got INSERTED into one same viral genome, which may have required the same animal cell with multiple different viruses and even bacteria exchanging only the specific required portions and no more, which is something naturally implausible but completely possible within a lab setting. (then I add here the list from my previous posting in response to Jennifer Clarkson, adding that there, (most of those sequences are concatenated sequences).”I have also added here my last comparison of the sequences found in Nsp3 by A. V., highly specific both to COVID-19 and to HIV-1.

*The link by hero Robert F. Kennedy Jr. denouncing the big conflict of interests in which the NIH is involved:

*And this Fourth of July, I present here some of the current sounds of my dear nation:,, (saved at, as per today:…”

:— with Karen Wierwille Martin.

Important New Info. From Ex Intelligence Officer Dannion Brinkley

They just gave him higher security clearance so he can leak info.

I am no longer a Democrat



But I’m not a Pub either. No way. Politically I’ve been a Centrist for a long time which right now leans toward Justin Amash2020 who is actually my neighbor from West Grand Rapids. He grew up in this neighborhood and has actually visited my house.

I feel much better about myself being honest in the political stance I was raised to despise. My family are all liberal, far left-wing Obama worshippers, and believe he is the reincarnation of Jesus Christ, so…that’s not working for me. It’s just the government, not a church. That goes for the flag-waving, God toting Pubs too. My great grandfathers Townsend risked a limb or two and wrote the freedom of religion clause for the Flushing Remonstrance that was eventually included in the Bill of Rights. I’m not giving that one away. No establishment of religion in America!

The most nauseating part of this is that on my personal wall on Facebook, unless my picture is smiling and cute or pretty and I post little niceisms about my son or the weather, I’m absolutely ignored. If I post anything powerful against the panicdemic that is absolutely true from licensed physicians or nurses, or epidemiologists, I’m ignored. I really want to unfriend every one of them that have dissed me because I’m opinionated and an activist for physical and financial sovereignty in a culture that views human beings as stupid commodities to be manipulated until the funeral industry can make a pretty penny off of your death.

I want to create a new, powerful, more outspoken than ever persona that is as calm, lucid, intelligent, and beautiful to the point where no one can see me coming. I’m not bothering with resisting idiots, I’m BEING who I am in my full power and could care less what anyone’s reaction is. Facts are facts. Feelings are feelings. We are each free under our Constitution. If you believe the news media or watch a lot of TV your brain is fried and I’m not helping you. I want to be intimidating. I do think it’s better to be feared than loved on this planet of little human love.

What I can’t quite figure out is the odd time fold where my mind flipped fully away from liberal, left-wing thinking. For years, I’ve found the Disney trope of Democrat to be nauseating; their fear of anything outside of their comfy Protestant church service, hometown, their grandchildren and quilting to be mind-numbing, their WASPYness making me crave a raft of ants in the rainforest to gobble them up. (Wasp vs. Antman).

The Trump lovers on Twitter are even bothering me. I fully support disclosure of 100  years of secrets regarding the ET’s and tech but I wonder how it’s going to happen without the liberals losing their minds. Hillary and her elite clique being Luciferian, bloodthirsty pedophiles I don’t find hard to believe but if they really let this out some Americans will go over the cliff. Are the rightwingers serious that we are supposed to believe that there are NO REPUBLICAN Luciferians? , the Pubs are lily-white on this issue? No way. The entire government is corrupt and all the institutions with it.

I’m not sure what this new world will bring but I’ve most definitely run away from home, far, far away from the National House and I’m never coming back. They are the biggest pack of liars and their followers the biggest flock of sheeple I’ve ever seen.


Essay; A Woman’s Ego


Woman on a mountain

I originally blogged this on August 26, 2013; 6 years ago.

The book I wrote, “Healer” has a section on bonding; page 240.  Like most people, I believe that men and women have a tremendous amount in common biologically.  And I really do like most men.  However, socially, on Facebook, and in the town, I live in, the more I talk, as a literate person, as an intelligent woman with self-esteem that isn’t a doormat, as a woman who is a small business owner, the more I get called names like “egotistical” and “pathetic”.

So I decided to think about the difference between a woman’s ego and a man’s ego. There are books and articles about a man’s ego all over the place. The “fragile male ego” is well known.  But the woman’s ego?  Imagine, the “fragile female ego” being bandied about.  It’s more like, “New discovery!  Women have an ego! Make a flag for them!”

The definition of the ego is a sense of “yourself” or “self-centered”. Everyone starts out at a young age with a natural inborn sense of who they are as a person unless your parents or religion beat it out of you. That’s possible and maybe prevalent, but not healthy at all. People do tend to feel more secure if they agree with one another.  It’s curious.

A woman…with a sense of “herself”, pride, dignity, accomplished….well, she doesn’t sound very sexy.  Or does she?  Why do I assume she has to sound sexy? She doesn’t have to but women want sex probably more than men do. If you described a man that way it’s sexy.

There’s our first red flag. Women are given the message early on that their attractiveness as a potential mate, for the purposes of reproduction, should define their sense of self-worth. Thus the obsession with superficial looks as opposed to a big brain, articulateness, education, in essence, the character Amy Farafowler on “Big Bang Theory” (who I love). It’s just starting to catch on. And we are ever so grateful to Dr. Barbie and Corporate Manager Barbie to serve as a role model for young girls.

Yes, women have an ego.  Yes, women have a sense of themselves as an individual. Our needs with regard to education, intelligence, level of respect and pay in the workplace, respect in the home, respect from our sons, access to team sports, are EQUAL to men.

I suppose I’ll spend the rest of my life writing and living an example of a woman with an ego who loves.  You can’t love from emptiness.  You can’t love if your body is falling apart because you’ve given your last ounce of life force to everyone else. Women can be an example of how to take care of ourselves first and then whoever else we prefer to care for.



Essay; Sexual Shaming of Men



I’ve been thinking about this issue for about a year now but it coalesced last night when I read a quite long, but well-thought-out blog post on this site that made light of how many women absorb shame from men when we have sex with them. Before that, we’re fine, happy with ourselves, like being a woman, and like our bodies. I think women are getting better at accepting our bodies as they are and the media is helping with that. I know I am. There are more women of all different sizes on T.V. and in all media. The SIZE SHAMING, no matter what size, has decreased. More women understand that it’s more important for us to love ourselves than to please a man.

But, reading her blog, I immediately related to the experience of being mystified as to why a man I was with would turn pornographic in his tone, talked about how hot I was, did the sweetie, beautiful “speak” and then wanted to get sexually nasty as opposed to sensuous and intimate. My assumption is it’s the testosterone and most women consider it normal. The last lover I had said, “Why do you have to be so seductive?” “Me? Seductive?” I’m a chipmunk! What was he talking about? I don’t think he was seeing who I was; he was seeing who he wanted and needed to see. He was projecting. Women are individuals not porn stars and it’s objectifying to treat us like we’re part of your MENTAL fantasy, not a person in front of you. But again, I’m not sure men can help it because of the shame they’re socialized with. Their minds are all cluttered up with objectifying materialism which makes them feel better. Their feelings are stimulated by things; women’s bodies, food, cars, houses, boats, and on and on. I’m not sure women understand this.

How much does that happen? Probably all the time. It’s men’s fantasy need of having a car or motorcycle that reminds them of a childhood toy that they loved. Then they imagined they were a superhero on that vehicle and some adult males still do it. They get a life-sized one and keep the fantasy going. It’s objectification that transfers over to sex with a woman. I suppose this underlies the barely clad woman advertising a car that is so nauseating to us.

It’s something to keep in mind that men probably watch a tremendous amount of porn because they can’t express their sexual feelings as much as they need to or the way they want to in our civilization that shames it. Most men are not relational, not romantic and don’t want to be yet many women need that to be turned on! If he acquiesced, he would be too much like a woman and he’s not a woman, he’s a man, which means he’s a part wild animal, part human. Not all men are of course but most of them are. It’s scary for some women like me when they turn wild animal. I guess other women like it.

I think that men project a lot onto women, as though it’s our issue, about how turned on they are by feeling ashamed, nasty, or mean. OR…is shame projected on to them from all sides FOR BEING male as though they are expected to be like that even if they are not? The writer I read didn’t say that in her blog or maybe she doesn’t understand it.  I think men get turned on by feeling repulsed. They’re attracted to women and things that are not nice and that are uncivilized and wild. It’s all that testosterone blasting through their brains that blows everything up. It’s the opposite of most women. I know some women are attracted to pain and ugliness, like a sadistic thing but it’s not terribly common. Still, I’m not judging it. Nevertheless, I am not that way.

It appears to me that everything in our civilization exists as it is to control men’s sexual nature and make things peaceable for women and children. Before, most of the time it was working. NOW, society seems to be tearing itself apart because men’s sexual nature is finally coming to the surface, there is more awareness of abuse of women and children, guns are everywhere which men love (you don’t see women using them in public much), we see incest, pedophilia, and sex trafficking at the highest levels of institutions, all the lies, and control about it are coming forward, the institutions don’t know exactly how to lie about it anymore. Men are victims of the system too otherwise they wouldn’t be victimizing those more vulnerable than them. It’s a trickle-down from the women and men in power who hold the system in place.

Civilization uses guilt, shame, control, incarceration, blaming women, sports, and the media all to LIE about men’s sexual nature. I guess we’re still working on a balance to our civilization as though it’s progressed from being in the wild. Sometimes I think it’s worse because it represses the true feelings and then they explode to the surface.



Mindset; What does “In Your Face” Mean from a Woman?

Women leading

This article is dated May this year. There are a few articles every year to remind us that this Victorian issue is alive and well. Some women just don’t get it and they keep planting seeds of injustice in our minds and then we carry it with us wherever we go in society. I guess we need to set a strong boundary.

Here is the article.

Double Standards That Hold Women Back

Under the top picture, it says,

Women can rarely just be themselves in positions of power.”

This is the first paragraph.

“I suggested she—a rising female attorney at a law firm—be more assertive to make her ideas and opinions heard in meetings. She told me she’s compelled to filter every word lest she is perceived as overly ambitious—or worse, aggressive. She noted that her male counterparts, by comparison, seemed to feel free to say whatever, whenever, without incurring any negative judgment.

She wasn’t wrong—she really did need to choose her words more carefully than the men.”

That’s because Mom said so. Mom knows best. Yeah, no. It’s holding me back with that voice ringing in my head, “Don’t be in your face.”

This next part is just unbelievable and utter crap.

“Women typically rank higher than men on “agreeableness”—they have a reputation for being more nurturing, empathetic, kind, supporting, and accommodating. If you’re a female executive who others consider agreeable, chances are you will be seen as more likable.

But leadership positions require people to command authority. Aggressiveness will do this for you. But for women, the more aggressive they are seen to be, the less likable they are found—by men and women. It’s a double bind.”

There is still a huge chasm between social permission for a man to be assertive and even aggressive and a woman to be the same. This article from Forbes proves that in the year 2019 it’s still alive and kicking despite all of our hope and denouncements. There is also a generational divide here. My mother born in 1940 still projects her values regarding what she was taught about how to behave as a woman onto me because that’s what she is still doing. She’s trying to justify it through me. So do women from my own generation. She still feels free to direct me on what to do as well.

The double standard between women and men being assertive needs to end. The truth is, more women are far more assertive than men and just as competent! I could write about this forever but do read the article and try not to be in denial in your own workplace.



Essay; The Honest Middle Ground

man and woman

My last post, I made the point that I’m not interested in fawning adoration that leads to possessive marriage. Every woman I know is at a different point with this but it has to do with emotional maturity and financial independence. Most women don’t prefer marriage, from what I’ve gathered, unless they’re getting some type of needed security. But most of us aren’t interested in shallow hook-ups either! Some men get this, some don’t. It’s hard to believe. We know respecting a woman may be a turn-off to most men but you have to show respect to most women. We can tell if you’re sincere or not.

I’ll speak for myself

Friendship, attraction, love, and care are what I want and need. It’s the honest middle ground. Women are human beings. Does it really depend on what culture you come from as to whether you treat women as human beings? This needs to be a universal understanding. Possession in marriage, to some of us, is an insult. I’m a free person with my own life, work, and money. I’m not on the planet to soothe a man’s ego just as he is not soothing mine! Promiscuity is a hook-up with a stranger and is also an insult as I’m not a sex toy or the least bit turned on by strange men, for god’s sake. I guess I’m making the assumption that true love in marriage is Disneyland in my view. I know many disagree with me and that’s fine. I’ll entertain the notion but I’ve been married three times and there has never been true love.

Promiscuity or Possession

They are two far ends of the patriarchal spectrum that have been dominating our rules of relationships for hundreds of years. Lack of boundaries on the promiscuity end or lying on the possession end with a double standard applied to women allow men to rule the day. For men, getting continual sex by feigning a relationship via marriage has been the ritual. It also raises their status. For women, getting a fake, romantic relationship by giving sex in marriage has been the way women have manifested their true love; our children. That’s not good for women or children. I prefer mutual love with a man, not my children. Children end up rebelling against their parents anyway as it is nature. Women are adults and our roles and skills exceed motherhood. Children grow up and the parents need to let them go! It’s very dysfunctional not to. It’s a bad deal where no ones needs really get met, thus the divorce rate. That, and barely anyone is telling the truth; women or men.

The Honest Middle Ground

Lovers; Cat-type women could mate with cat-type men. I already posted on it. We tend to be interdependent and intelligent. Being a cat-type woman, I’ve been called strong and stubborn far too much. I am neither of those. In fact, I’m extremely warm, soft, sensitive, and vulnerable inside. It gives me a very strong heart. Stubborn is a misnomer. I know my own mind, what I need and say it and do it myself. That is still extremely taboo in our culture which still places coddling the male ego above everyone and everything else.

Are you a cat or a dog?

Bitches could mate with dog-type men that need a controlling trainer, someone willing to teach them how to be humane and will feed and groom them. If your man tends to be hungry and looks at you like a roast chicken then this may be the one for you. Many women are into this and many men find it sexy. I don’t but that’s because I’m a cat. Still, I don’t judge the bitches! I remember as a young girl realizing I wasn’t willing to function in this role with men. It’s a funny memory and really speaks to my inner nature. I’m finally honoring it without judging myself.

There is Much Wiggle Room

I’m not sure about the rest of the details but they depend on your couple dynamic. Are you polyamorous lovers or monogamous? Cheating on your monogamous girlfriend who is mad at you and has put you out of the house and into the dog house is not a license to be polyamorous by the way. You need to discuss the issue and either move forward or break up. My Twin Flame tried to pull this one. He was treating me like a possible option without telling me a woman with her toothbrush lives with him! I think deep down he’s a cat but he’s acting like a dog at the moment so no doubt he needs a bitch trainer. That’s fine with me. I’m not doing it. He is extremely intelligent, creative, and independent but I think he judges himself for it because most of the men in his culture are not cats. He very much seeks to fit in socially. He does tend to have himself in a provincial, cultural box that makes me want to scream. There is something else holding him up emotionally. I know what it is but I digress. Time will tell.

Men, be careful approaching women you don’t know. Are they cat-like or dog-like? Don’t make assumptions! The same goes for women. You need to know who you’re dealing with and the rest is negotiable.





Essay; 10 Reasons It’s Hard For Smart Women To Find Love

1. They aren’t afraid to be by themselves.

Smart women know what they want and aren’t willing to settle for anything less. They know the importance of staying true to themselves and they also realize that sacrificing their needs for the sake of love with the wrong person will only cause resentment in the long run. They do not have to settle out of fear of being alone, or fear of social implications by others’ who do not understand a woman’s ability to be by herself and be happy.

2. They know what they want.

Every woman has a mental “checklist” of what they are looking for in a significant other. A smart woman’s checklist tends to be either longer or more specific than those who want a significant other, just to have a significant other. They know themselves and in turn, know what type of person they can and can’t be with.

3. They don’t need another person to facilitate their lifestyle.

The past portrays that women needed to go straight from their father’s house to their husband’s. In the modern world women no longer need another person to help them live on their own; they may have realized they prefer that alone time. Therefore, knowing that they will eventually have to share that space can be scary for an independent woman.

4. They have other commitments that take priority over dating.

Careers, friendships, family, extra-curricular pursuits, whatever it is that she has going on may not allow for as much time to date as it takes to find the right mate.

5. They are hyper-aware that relationships end and can let their knowledge of the past affect their future potential relationships.

They have a harder time “living in the moment” and do not want to waste their time; as time truly is a valuable asset to a smart woman. They need to know that there is a future and that their potential mate is on the same page.  Marriages, kids, finances, etc.

6. They know that attraction is only half the battle.

Physical attraction is an important aspect of finding love, but smart women understand that attraction is fleeting and can be altered once you see what is underneath.  While a woman’s hormones tend to make the first step towards finding love, smart women understand that it is the intimacy developed (and maintained) by both people that dictate whether or not a relationship can last.

7. They can be intimidating.

When a woman is intelligent she isn’t afraid to stand up and say what she thinks. This is a hard pill for a lot of people to swallow. Whether it’s because they don’t know how to react, or if it’s because they don’t feel they can live up to her expectations; either way, it can be somewhat intimidating for potential lovers and even friends.

8. They understand change.

They don’t pretend that they, and their partners, will be the same person years down the road. They want to grow and they have ambitions for their futures that will change who they are, and ultimately, what they want. Knowing this makes it harder for a woman to commit to a partner for a long period of time.

9. They have a vast understanding of modern dating practices and don’t necessarily like, nor agree, with them.

Dating is no longer a means of survival for women. As stated before, since we no longer need to be passed from father to husband as well as we have the capability to live alone – dating is truly meant to find a companion whom you love and want to share your life, interests, and future with.

10. They know not to trust their hearts with just anyone.

This reason is the culmination of all of the ways it is harder for smart women to find love. Deciding whether someone is worthy of an intelligent woman’s heart is not an easy task and we do not take it lightly. Intelligent women have to weigh the pro’s and con’s and decide if the risk of loving another person is worth the devastation that can occur if it doesn’t work out.