The Artificial Covid19 Sequence Will Likely be Unsuitable For a Vaccine. By Dr. Fernando Castro Chavez.

Dr. Chavez is currently working with the 2008 Nobel Laureate Luc Montagnier, the founder of the HIV retrovirus, on fleshing out the true nature of the Covid19 signature and he’s my friend. In between his important work I’ll get his attention, which I already have somewhat since he is familiar with the Mayan system as well and we are on the same page as we talk. Much of his work has fueled my project and I’m very grateful. -Lisa T.

“To the current director of the NIH:

As a Postdoctoral student of Molecular Biology, my focus has been on analyzing the sequence of the current COVID-19. It is so alarming to find the artificiality within it, that I have written to NIH director Frances S. Collins, entitled “A Vital Letter On The Preservation Of Humanity As We Know It”:

Dr. Collins,

As I have had the blessed confidence to write to a brother in Christ since day one, I am sending you this important message. With my best regards,
Fernando Castro-Chavez, PhD.

P.S:
I could not fit this vital link into the letter that independently exposes the hoax imposed on humanity 19 years ago. Let us do all we can to prevent this from happening again but on a wider scale.

AT LEAST SIX RESEARCH GROUPS HAVE FOUND HIV INSERTS IN SARS-CoV-2

Sir,

Prompted by this article: Jun 25, 2020 – Health: The NIH claims joint ownership of Moderna’s coronavirus vaccine: https://www.axios.com/moderna-nih-coronavirus-vaccine-ownership-agreements-22051c42-2dee-4b19-938d-099afd71f6a0.html (https://archive.vn/TArE3), I write to you, saying that we had a deep respect for you (my sister, my girl companion and my peers). The first letter I wrote to you was about Creation, in 2000, just having arrived from my country, written in bad English at least I was willing to live the American dream!!!

Then, we saw you in person and introduced ourselves. You went to the BMC to give a speech about The Human Genome Project, I remember that you said something like: “Mendel is also there, in this slide, right there at the corner…”; then I wrote about our dreams to pursue, not only this Postdoctoral couple of jobs in Medicine but also an MD Career. We two are starting again from scratch. Dreaming to be truthful and to really help humanity… However, now, I dedicate myself to you my current findings, humble, but nonetheless, they are still findings:

1) “COVID-19: AATGGTACTAAGAGG (NGTKR) = HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene (GU455503)”. Finding also done by:

2) Shi Zheng-Li, from the WIV at Wuhan and co-author of Ralph Baric. She distinctively calls it an “INSERTION” (she puts it as GTNGTKR, GGGACCAATGGTACTAAGAGG, adding other two more, but skipping the key one: The Furin Site!), whose putative function is immunosuppressant, as she says that those INSERTIONS have: “sialic-acid-binding activity”, at Zhou, P., plus 27 et al & Zheng-Li Shi.A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020:579:270-73, & 16pp: https://www.nature.com/articles/s41586-020-2012-7.pdf; a third group that found these unique INSERTS is that of:

3) Sørensen (identical to the previous one: GTNGTKR, but also studying, to leave no doubts, its functional span by performing 6 by 6 NT iterations containing our sequence of interest (and of many others), such as VSGTNG, SGTNGT, TNGTKR, NGTKRF, etc.), who says in an interview, as he found many more INSERTS (saved at https://archive.vn/7TPTc): “The INSERTED sequences have a functionality that we describe.

We explain why they are essential: …accumulated charge from inserts and salt bridges are in surface positions capable of binding with cell membrane components other than the ACE2 receptor.” This statement is very important and indicates that if we realize that this virus is NOT natural we could be and could have been better prepared since the start to fight against it in a more logical, rational, and prepared way, which did not happen. The artificiality of the virus also makes it unsuitable for vaccination, instead of the opposite, because that is the way the human tampering of nature works. The attempted purpose of its design is to do one thing, and it happens to result in just the opposite thing than what was wanted: “…the naked coronavirus spike protein as a concept for the basis of a vaccine, which we have rejected because of a high risk of contamination with human-like epitopes.

Analysis of the Spike protein of SARS-CoV-2 shows 78.4% similarity with human-like (HL) epitopes…” and “… A search so tailored to match against all human known proteins will give a 78.4% human similarity to the SARS-CoV-2 Spike protein, i.e. if all epitopes on the 1255 amino acid long SARS-CoV-2 Spike protein can be used by antibodies then there will be 983 antibody binding sites which also could bind to epitopes on human proteins…”The original article delving into all of those technicians is: Sørensen, B., Susrud, A. and Dalgleish, A.G. Biovacc-19: A Candidate Vaccine for Covid-19 (SARS-CoV-2) Developed from Analysis of its General Method of Action for Infectivity. QRB Discovery (by Cambridge University Press) 2020:17 pp [Accepted Manuscript]: https://doi.org/10.1017/qrd.2020.8.

This important article clearly indicates that if we do NOT realize the real origin and the real nature of this virus, we will continue to be deceived as per its treatment and its strategies of attack, and will be responsible for having on purpose dimmed the light of its artificial origin. Especially when we all are aware that the authors of “The Proximal…”, Andersen et al. Nat. Med. 2020 article have been written by reefers that have ever been used for political purposes rather than scientific ones.

So, apart from as these three independent findings of that and many more related HIV sequences, we have another two sets of witnesses, totaling FIVE independent groups finding this: Mine, Zheng-Li’s, and Sørensen’s, but also:

4) Pradhan, from the Indian group that was forced to withdraw its article, who calls the contained sequence under consideration as the previous ones: “INSERT 1″: TNGTKR, elongating the set of meaningful nucleotides as TCTGGGACCAATGGTACTAAGAGG (SGTNGTKR): Pradhan, P. et al. Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag. Biorxiv 2020: 14 pp. (Withdrawn, 128 comments): https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1, they start describing their findings as follows:”We found four new insertions in the protein of 2019-nCoV- “GTNGTKR” (IS1)…”, but this is not all, but also a fifth group, being this the one integrated by:5) Perez and Montagnier (2008 Nobel Prize in Medicine, precisely for his discovery of the HIV virus), and they describe our found sequence within, together with a couple of tens more: TCT GGG ACC AAT GGT ACT AAG AGG TTT GAT AAC CCT G (SGTNGTKRFDNP…, finding them in here, fragments of SIV joined to the HIV-1A that I found, and sown in point “1”), from these sequences found by them, they start and end their meaningful conclusions, coming from the wisest of men, as follows:1) 18 RNA fragments of homology equal or more than 80% with human or simian retroviruses have been found in the COVID_19 genome;

2) These fragments are 18 to 30 nucleotides long and therefore have the potential to modify the gene expression of Covid19. We have named them external Informative Elements or EIE;

3) These EIE are not dispersed randomly, but are concentrated in a small part of the COVID_19 genome… …everything converges towards possible laboratory manipulations which contributed to modifications of the genome of COVID_19, but also, very probably much older SARS, with perhaps this double objective of vaccine design and of “gain of function” in terms of penetration of this virus into the cell. This analysis, made in silico, is dedicated to the real authors of Coronavirus COVID_19. It belongs only to them to describe their own experiments and why it turned into a world disaster: 400 000 lives, more than those taken by the two atomic bombs of Hiroshima and Nagasaki.

We, the survivors, should take lessons from this serious alert for the future of humanity. We urge our colleagues’ scientists and medical doctors to respect ethical rules as expressed by Hippocrates oath: do no harm, never and never!”; an earlier manuscript of them can be found at Perez, J.-C., and Montagnier, L. COVID-19, SARS and Bats Coronaviruses Genomes Unexpected Exogenous RNA Sequences. ResearchGate & OSF 2020:43 pp. [Older Manuscript]: https://osf.io/d9e5g/download/?format=pdf.

I started my letter saying that I used to have respect for you. However, the standing taken as to ignore the real origins documented by these five research groups and by countless others, of the whole pre-planning of the current Pandemic by COVID-19, has made me change my current opinion about you.

6)Arumugham also discusses such “Artificial selection at work… via recombination with HIV-1 derived inserts and selecting the viruses for efficient human kidney cell infection”, and my comment is again that to notice this artificial origin of COVID-19 is very important to do the proper treatment to patients, and to prevent another thing like this from emerging out of a Gain of Function “research”: Arumugham, V. Root cause of COVID-19? Biotechnology’s dirty secret: Contamination.Bioinformatics evidence demonstrates that SARS-CoV-2 was created in a laboratory, unlikely to be a bioweapon but most likely a result of sloppy experiments. Zenodo 2020:9 pp. (Manuscript saved at: https://archive.vn/N79Ci): https://zenodo.org/record/3766463#.Xuu9RTpKjIW

My experience on finding human artifacts on genomes dates back to the EcoRI palindromic linker that is contaminating thousands of sequences in the Genbank: Castro-Chavez, F. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes. DNA Cell Biol. 2012, 31(2):151-63: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3272245/

The freedoms of the whole humanity are at stake and the good God The Creator that you deeply respect, has put you in a key position as to be able to revert as soon as possible the current decline of the human values, and of the human nature in general, and this all because of a deliberate release of the current Sars-CoV-2. 9/11. It was the first False Flag Operation aimed at stealing as many freedoms as possible from the human race, and the Fake Anthrax Attack of 2001 had the same purpose, releasing a pre-planned and the very anti-patriotic document called the “Patriot” Act, which also included an immunity clause preventing the Pharmaceutical Industry of even more liabilities, but it was contested by the population, and it was removed. So, I wish to stop the GoF initiatives.

Here we are today, contesting the “official” narrative of the current Plandemic as we did in the past with the “official” narratives of 9/11 when we discovered nano-bombs and fake planes injected into the TV screens. I expect to publish this letter out in the open after you have read it. Only history will tell if TRUTH was able to win on this time over darkness, or if the criminals will get away once more… With my same thinking as at the beginning of the current letter (but praying that this could very soon change),

Fernando Castro-Chavez, PhD.

P. S.

My ongoing work can be found at the ResearchGate. While many pieces of it have been removed from Facebook and from the YouTube by some heartless and brainless censors appointed by the WHO and by their owner, Bill Gates, apparently the mastermind, chosen by the globalists to pull this event of an artificially manufactured viral harm for the whole of humanity, it is there. But as Mordechai told to Esther: “If you do nothing about it, God will raise somebody else to redeem us of this plague, because our clamors for freedom and for justice have already reached the Heavens”. Jesus said that it will not be so easy for the believers to overcome evil in the current times, but that it could be possible. As Christian believers, we believe that as long as we continue over the earth, the total fruition of the plans of darkness can NOT prosper, and you may be a key member of the Body of Christ in order to fulfill such restraining against the forces of evil of this world. Thus far, the next are some of the sequences that seem to be inserted (some of them seem to have been started to be tampered with since the RaTG13 “experiment” of Shi Zheng-Li, a genome she had since 2013 but that she did not publish until 2020 after the first Sars-CoV-2 had been published in China, a genome that of the RaTG13 (previously published in part twice with different names that included the number 4991.

That is dishonesty in science to change the names of the sequences, and that is what Shi just did!). It has been used, ironically, even with all its methodological anomalies, to precisely attempt to undermine the artificiality of the inserts. Even two sequences published earlier by the Chinese Military seem to have been already tampered with to make them more infectious. This is what happens when you only have the sequences provided by them with nobody else corroborating their authenticity), so, I may use the “probable” inserts clause, mostly from HIV-1, some few from HIV-2 and one from SIV (as explained by Perez & Montagnier, 2020).

So, the number of artificial sequences is growing as research progresses, that is why, when people try to discredit some of these from being artificially made, the burden is over them to explain how all of them got INSERTED into one same viral genome, which may have required the same animal cell with multiple different viruses and even bacteria exchanging only the specific required portions and no more, which is something naturally implausible but completely possible within a lab setting. (then I add here the list from my previous posting in response to Jennifer Clarkson, adding that there, (most of those sequences are concatenated sequences).”I have also added here my last comparison of the sequences found in Nsp3 by A. V., highly specific both to COVID-19 and to HIV-1.

*The link by hero Robert F. Kennedy Jr. denouncing the big conflict of interests in which the NIH is involved: https://www.instagram.com/p/CCAcwVkHCec

*And this Fourth of July, I present here some of the current sounds of my dear nation: https://archive.vn/THJ2h, https://ourrescue.org/, https://qmap.pub/ (saved at, as per today: https://archive.vn/Us7O8)…”

: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031— with Karen Wierwille Martin.

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google photo

You are commenting using your Google account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s

This site uses Akismet to reduce spam. Learn how your comment data is processed.